Anthropology.net

Beyond bones & stones

Archive for December 2007

Four Stone Hearth 31 at Walking The Berkshires – Wednesday January 2nd – Call for Submissions

leave a comment »

The next edition of the anthropology blog carnival Four Stone Hearth will be at Walking The Berkshires, this coming Wednesday, January 2nd, so if you’d like to submit written content of your own, or indeed content you’ve read elsewhere, please send it along to submit@fourstonehearth.net, or directly to the hosting site itself, greensleevesenviro AT sbcglobal DOT net.

Many thanks to everyone who has contributed to Four Stone Hearth over the past year, and just to wish everyone all the best for 2008.

Written by Tim Jones

December 31, 2007 at 6:01 pm

Posted in Announcement, Blog

Watch Discovery Channel’s Bone Detectives

with 3 comments

I’ve been on a much needed time out from blogging. The last half dozen or so posts from me have been embarrassingly personal and critical, so I decided to take a hiatus while on vacation to tone down the bitterness. But my break didn’t keep me from following current anthropology news. Far from it, I’ve definately been reading up a lot, I even finished a book that I’ll be reviewing soon.

Discovery Channel’s Bone DetectivesWhen I returned, I stumbled upon a new show on the Discovery Channel that should interest all your forensic anthropology slash archaeology buffs out there. The show is called Bone Detectives, and the premise is to portray how archaeologists and forensic anthropologists reconstruct the daily life of people recovered from archaeological sites. The host is Scotty Brian Moore, and his bio on the show’s site says he’s still wrapping up his dissertation from the University of Washington. He’s got a wealth of experiences and what not though.

The show airs on Monday’s at 10 p.m. starting January 14th, 2008 but there’s a sneak peak of episode 1 on Saturday, Dec 29th 2007, at 10 p.m. The sneak peak episode will cover the unearthing of Mayan warriors, priests and the elite. I wonder if they’ll ever cover what I call the archaeology of the plebeian? It ain’t glamorous as covering dead kings, but often it is more informative on understanding how normal people lived. We’ll see if they cover this aspect of archaeology. The listings of the schedule for the first four episodes doesn’t seem like they’ll be covering anything but royal and religious archaeology.

Written by Kambiz Kamrani

December 27, 2007 at 1:12 pm

Four Stone Hearth XXX @ The Greenbelt

with 2 comments

The anthropology blog carnival Four Stone Hearth has hit the big three-o, and this time round, FCD Ridger at The Greenbelt is our host, so head on over to read her excellent compilation of posts and essays from around the blogosphere.

The next edition of this blog carnival, and the first of 2008, will be a brisk constitutional at Walking The Berkshires, on January 2nd, so there’s plenty of time to get those ideas and posts together for next time round.

Written by Tim Jones

December 19, 2007 at 6:44 am

Posted in Announcement, Blog

Four Stone Hearth 30 @ The Greenbelt, Dec. 19th – Call for Submissions

leave a comment »

There’s still plenty of time to submit articles for the next edition of the anthropology blog carnival, Four Stone Hearth, over at The Greenbelt, so if you have written or read something you consider suitable for the event, please send it along, either to kmdavisus AT yahoo dot com, or to submit@fourstonehearth.net.

There are also hosting spots available from March 12th, so if you’d like to apply to host an edition on your own site or blog, here’s the link – host@fourstonehearth.net

Written by Tim Jones

December 16, 2007 at 6:51 am

Posted in Announcement, Blog

A Human Ancestor for the Apes?

with 85 comments

Do we really need to consider turning everything upside down by considering the existence of a human ancestor for the apes? This suggestion definitely has the quality of blasphemy against religious doctrine. It just feels wrong and goes against our deeply held beliefs and understanding of the world.

However, this is exactly where the evidence leads.

Overall, I don’t expect that the entire anthropology community will suddenly abandon everything that has been taught for decades. However, my point is the following:

  1. We see the spine anatomy of a hindlimb supported upright ape in Morotopithecus, Pierolapithecus, Oreopithecus. The data is compelling and extensive – and I have detailed it in technical raw data form in my book: Axial Character Seriation in Mammals, which republishes my Harvard PhD Thesis. The underlying patterns are extracted and synthesized in my recent PLoS ONE paper “Homeotic Evolution of the Mammals, Diversification of Therian Axial Seriation and a Morphogenetic Basis for Human Origins” and in my Neurosurgical Focus article. The context in evolutionary theory is explained in my recent book “The Upright Ape: A New Origin of the Species” which has a foreword by David Pilbeam – currently Dean of Harvard College and certainly one the most knowledgeable and experienced paleoanthropologists in the world.
  2. We have evidence of an upright hindlimb supported Orrorin based on the femur and Sahelanthropus based on the skull.
  3. There is no convincing fossil evidence at all of a non-bipdeal hominoid outside of the proconsulid group.
  4. We have an early outgroup whose infants have innate bipedal walking (see the video Hominiform Progression). The Siamang video is interesting because of the innate bipedalism. As I point out in the video, John Fleagle has seen young siamangs of this age walk bipedally high in the canopy in Malaysia.

Cladogram of Hominoid Pelvic GirdleIt is typical to say that all of this is irrelevant and misleading and should be ignored. There was a quadrupedal common ancestor for chimps and humans and the human lineage suddenly and majestically stood up about 5-6 million years ago. However, I feel that there is no a priori reason why we must ignore all of the evidence for early bipedalism.
None of the skeletal evidence can ultimately distinguish between “short bursts” and long distance bipedalism as Kambiz points out in his post. My focus is on the character state and whether the crucial anatomical basis is a shared derived feature of a hominiform clade.

It can certainly be said that the siamangs only engage in bipedalism for short bursts, but that is also true of their brachiation. Similarly, the chimps and gorillas knuckle walk and the orangutans fist walk only in short bursts. However, the important point is that chimps, gorillas and orangutans seem to locomote in diagonal posture more than 90% of the time and only occasionally deploy a short burst of bipedal walking. I would argue that they have very bad spinal architecture for bipedal walking. On the other hand, hylobatids use bipedalism 100% of the time when they locomote on the ground no matter how long the burst of activity. If a hylobatid has to travel a long distance on the ground – it does not lapse into a quadurpedal gait – it just keeps walking bipedally. There is an important difference in the role of bipedalism as deployed by hylobatids and hominines as opposed to what we see in chimps, gorillas and orangutans.

This would be a morphogenetic origin for upright bipedal walking rather than an adaptive origin. Essentially, the origin of upright posture was not driven by any ecological scenario, but rather occurred suddenly as a result of a morphogenetic mutation in the Pax genes. Various descendant forms will have lived in various environments with variously optimized versions of primary upright bipedalism on large horizontal arboreal supports and on the ground.

It is certainly easier to assert that Morotopithecus was upright and hindlimb supported – based on spinal anatomy – than to prove it was primarily bipedal or a long distance walker. Gibbon Walking on a VineHowever, this is where the video showing the baby siamang learning to walk bipedally is relevant. Yes, you could argue that innate bipedalism evolved independently in parallel in hylobatids and hominines, but is also reasonable to consider that since this is so unusual, that it reflects descent from a common ancestor that had this feature. Essentially – an eight month old Morotopithecus baby would do the same thing that we see in the two descendant groups (hominines and hylobatids) – the baby would innately begin to walk bipedally as it’s primary locomotor pattern.

So – if the chimp-human split did take place 6 million years ago (as the molecular data suggests), then what do we do with Sahelanthropus which many believe was a full time upright biped but which lived 7 million years ago?

If you want a slow gradual evolution of bipedalism, you need to push the chimp human split back to say 8 million years. However, there is an alternative explanation. Upright bipedalism was already the primary means of locomotion in the common ancestor of chimps and humans – Sahelanthropus is ancestral to both lines.

What defines a “human?” I have taken the position that it is a body plan (bauplan). Most of us have accepted that early Australopithecines whose brains and skulls were chimp-like, should be considered human and not ape. When you find a fossil such as Sahelanthropus that has a “chimp-like” skull from the point of view of its face and brain, but has the skull base of a human (and presumably upright bipedal post-cranial anatomy) – how can you tell from the fossil if it’s an ape or a human?

The Hennigian cladistic approach lets us say that the isolation point between the chimp and human lineages – where hybridization became impossible – is the origin point of humans. However this means that the definition is arbitrary since ape and human would pretty much look identical at that time.

Illustrations of Hominoids

SNT Transposition

Another alternative is to stick with our current definition – a hominoid whose anatomy reveals that it is primarily an upright biped is a human. I have proposed the term “hominiform” to refer to a clade of hominoids that share the Morotopithecus spinal transformation (septo-neural transposition – in which the dorso-ventral plane of the body flips from ventral to the spinal canal to a new position dorsal to the spinal canal) and the styloid process is converted into a neomorphic hominiform lumbar transverse process. The Morotopithecus & Homo sapiens vertebraesynapomorphies would include innate bipedal walking in the infants.

Among hominiforms we have primitive “eubipedal” types (most Miocene and Pliocene fossil hominiforms, the hylobatids and the hominines) and derived “metabipedal” types (lineages of chimps, gorillas and orangutans) that have abandoned bipedalism as their primary locomotor pattern on the ground.

Sahelanthropus appears to be a human species that is representative of species in the line of ancestry to both the chimpanzees and hominines.

Aaron Filler, MD, PhD

Written by afiller

December 15, 2007 at 6:14 am

Evolution of Lordosis and Pregnancy

with 5 comments

The report published in Nature by Whitcome, Shapiro, and Lieberman reports on a longitudinal study of 19 pregnant women to show how the center of gravity moves forward as the pregnancy progresses and also identifies male/female differences in lumbar curvature or lordosis. Lordosis IllustrationThey make the point that this assembles into a neat evolutionary adaptationist story – females have more lumbar lordosis than males (sexual dimorphism) and this appears to be helpful for the unique demands of a pregnant upright biped. Katherine Whitcome is a research fellow, Liza Shapiro is a very experienced specialist in primate spinal evolution, and Daniel Lieberman has been very much involved in understanding the importance of long distance walking in human evolution.

The article doesn’t mention that there are numerous other reports about sexual dimorphism in the human lumbar lordosis – about half of the studies found no statistical difference between males and females and the other half found a small difference. All of these are referenced and updated in a recent article titled, “Radiographic Analysis of the Sagittal Alignment and Balance of the Spine in Asymptomatic Subject” by Vialle and colleagues (Journal of Bone and Joint Surgery Am. 2005, 87:260-7). Hence the idea of sexual difference here is not new and although the wedging measure used by Whitcome et al produced a statistically significant difference, it is not clear the wedgeing of bones equals real differences in lordosis and it is not clear that the sexual difference will hold up in larger studies. They don’t tell us why the other studies showed no sexual difference.

Nonetheless, the story makes the same point I have made in my books, Axial Character Seriation in Mammals and The Upright Ape: A New origin of the Species, as well as and in two recent articles – one on the evolutionary origins of back pain – in which I discuss the evolution of lordosis in the online journal Neurosurgical Focus, and the other, my article in the online journal PLoS ONE.

Most mammals have a lumbar spine whose architecture tends to passively resist the force of gravity when positioned in a horizontal or diagonal position. In humans and such ancestors as Morotopithecus, however, the spine mechanics are reversed so that quadrupedal stances are very tough on the spine. Only fully upright stance is comfortable. In the Neurosurgical Focus article, I also point out that the backward projection of the hip bone – the iliac crest (or more specifically the ‘posterior superior iliac spine’) gradually moves farther and farther posteriorly so that the back muscles can resist the weight of young carried in front. This provides another basis for understanding the time of onset of the lordosis. However, in the Neurosurgical Focus article, I also show how the conversion of the longissimus muscle attachment onto the lumbar transverse process would have been sufficient to allow for carrying infants in the Morotopithecus configuration as far back as 21.6 million years ago.

These findings further support the point that position that bipedal walking – full time bipedalism – may be very ancient in the hominoids. It also may explain why various hominoid lineages such as those leading to modern orangutans, chimps and gorillas abandoned upright bipedalism in favor of a re-engineered lumbar spine that could better resist the weight of the late term fetus during long distance travel in horizontal quadrupedal and diagonal postures.

Aaron Filler, MD, PhD
Institute for Spinal Disorders, Cedars Sinai Medical Center

Written by afiller

December 13, 2007 at 2:23 am

Welcoming Aaron Filler to Anthropology.net

with 2 comments

I’m in the middle of my finals week, and am stressed out. Coincidentally it happens to be a very big week in anthropology news. I know I haven’t reported on Hawks’ new human evolution acceleration paper and I just missed the new study suggesting that the curvature of the female human spine is an evolutionary adaptation to pregnancy. Aaron FillerIt disappoints me that I haven’t had the time to write about either… But I will have a chance in the next week or so when I find some more time to sit down and read up on both studies.

In the mean time, I’m happy to announce that my recent skepticism with a new hypothesis proposed by Dr. Aaron Filler has cumulated into him guest blogging for the site. If you don’t know Aaron Filler, he recently published “Homeotic Evolution in the Mammalia: Diversification of Therian Axial Seriation and the Morphogenetic Basis of Human Origins,” in PLoS One. He has a medical and doctorate degree and specializes neurosurgery. He been a director of Comprehensive Spine Center at UCLA. I’m pretty sure that is one of the places where he built up expertise with the structure and function of spine to suggest that the transformed hominiform type of lumbar vertebrate found in Morotopithecus bishopi suggests bipedalism originated about over 20 million years ago.

I’d like to welcome him to our site, I’m sure he’ll provide much more clarity than I’ve given on the subject. I can’t wait to read some posts from him as well as the comments that you all ask.

Written by Kambiz Kamrani

December 13, 2007 at 1:01 am

Digitizing Dance

with 7 comments

This short comical clip got me to think if anyone out there has considered digitizing dance? This is can be more than a new type of ethnographic research. One could not only digitize dance as a sort of cultural preservation but one could begin to do really interesting statistics and comparisons of cross cultural dances since data is plotted in physical space. Hell, it could even become a form of phylogenetic analysis, who knows?

Written by Kambiz Kamrani

December 11, 2007 at 9:38 pm

Aaron Filler’s Video Documents Bipedalism in Siamangs

with 3 comments

Aaron Filler published a very hard to accept paper about three months ago stating bipedalism could have originated 20 million or so years ago and all of the other great apes lost this adaptation whereas the human lineage kept it. Last night, he sent me three emails to share a new video where he describes,

“the details of knuckle walking in chimpanzees and gorillas, the graceful “quadrumanual” climbing of orangutans and the dramatic bipedalism of the siamang apes. These are contrasted with footage of human arm swinging and movement technology. The video also captures the various ways in which hominiform mothers carry their infants and children. “The definition of humanity can be found either in the upright bipedal hominiforms of the early Miocene, or in the dynamically inventive modern species we are now. The conflict between the biological and intellectual definition of humanity is a critical modern challenge for biology and philosophy” Filler says.”"

He’s provided some low resolution clips here and there on the internet, but has also put out a high resolution file for us to view. To make it easier on y’all, I rather not have each and everyone of you guys download a 260mb file to find out you may not have the right hardware or software to view it, so I’ve embedded the Google Video Filler provides here:

Again, Filler hopes that this video new video documents evidence of an upright bipedal ancestor for both the apes and humans existed way before what is commonly accepted. I remember learning in Adrienne Zihlman’s anthropology of movement class about different ape locomotion strategies, and of course we touched on how chimpanzee, orangutan, gorilla, and other apes like siamangs and gibbons move about. Almost all apes have bursts of bipedalism, however none have persistent bipedal locomotion like us. And from what I can tell, Filler says this clip of a 8 month old captive siamang learning to be bipedal fits his hypothesis… except the baby siamang is clearly learning, and even the older siamangs in the video walk bipedally in short bursts.

Despite this shortcoming, he cites this as definitive, ground breaking, evidence that the most primitive great apes were bipedal. But he completely skirts a discussion about siamangs and other gibbons being arboreal in the wild. In the dense jungles of Malaysia, Thailand, and Sumatra, these primates rarely have a need to come down onto the ground… and their bodies are a testament to this environment, with long arms to brachiate branches with. And this was all filmed in a much less dense zoo…

Written by Kambiz Kamrani

December 11, 2007 at 10:10 am

Anthropologist Meredith Small says DNA testing is a scam

with 5 comments

Here is Meredith Small, an anthropologist at Cornell University and a primatologist, who has focused her life work on observing behavior, writing a slam on DNA testing over at LiveScience. I don’t know how she gets the authority to call genetic ancestry testing a scam if she specializes in behavior.

But that’s really not the case, cause she has clearly shown, she doesn’t fully understand DNA testing. Blain Bettinger, the Genetic Genealogist, points this out to us. Here’s an example, where she sides with the opinions of Jonathan Marks,

“But, [anthropologist Jonathan] Marks points out, these companies are preying on the public because they simply don’t have enough comparative information to pinpoint a gene on a world map.”

Marks and Small, these genetic ancestry tests don’t isolate specific genes in populations. Instead, these tests mostly focus identifying haplotypes in the mitochondrial DNA which we inherit from our maternal lineage and, if we are male, our Y chromosomal DNA. Haplotypes are the unique composition of single nucleotide polymorphisms that we inherit as large fragments from our parents. They help classify us into our haplogroups. Once again, haplotypes are inherited as blocks. For example you can see how your segments of mtDNA matches up with other people who have similar haplotypes. If a population has a similar set of haplotypes, they are grouped in a haplogroup. This is how population genetics helps trace ancestry.

Some tests offer more resolution, in other words, they screen for more haplotypes, where as others are more general and can only identify down to a region of the Earth. Recently, in my PCR class, I sequenced part of my mitochondrial DNA. In the following post, I’m gonna describe to you what we can do with with this sequence and how we can tell where I came from. I hope Small and Marks will check this out.

After spitting in a tube, I isolated my DNA from my cells. Commonly, what happens next, is that a mix of primers, nucleotides, and polymerase enzyme is mixed into another tube with a small fraction of the DNA I isolated. The primers help polymerase identify and target the regions where haplogroups are, to amplify them. After running PCR, a chemical reaction where polymerase is activated and deactivated in multiple cycles, what I end up with is multiple copies of a set of haplotypes.

This is then sequenced. The sequence I get can be compared to a whole lot of other known sequences from people. If my sequence matches up with other people, we are more related than different. People from the same ethnicity tend to have similar sequences in sets of haplotypes. Here’s my sequence that I plucked out of the dLoop part of my mitochondrial DNA:


CAGATGTCGGATACAGTTCACTTTAGCTACCCCCAAGTGTTATGGGCCCGGAGCGAGGAGAGTAGCACTCTTGTGCGGGATATTGATTTCACGGAGGATGGTGGTCAAGGGACCCCTATCTGAGGGGGGTCATCCATGGGGACGAGAAGGGATTTGACTGTAATGTGCTATGTACGGTAAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGGGGTGGCTTTGGAGTTGCAGTTGATGTGTGATAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGTTTTGATGTGGATTGGGTTTTTATGTACTACAGGTGGTCAAGTATTTATGGTACCGTACAATATTCATGGTGGCTGGCAGTAATGTACGAAATACATAGCGGTTGTTGATGGGTGAGTCAATACTTGGGTGGG

Okay, so you’re asking, where in this string of nucleotides does it show where I’m from? This is were we must harness the comparative power of massive databases such as GenBank. Before we do, some people may think that this string is not significantly long enough to tell me about my heritage. It is… this sequence is 454 bases long, with 4 possibilities of bases per position, you can estimate that there are 4 454 different possibilities. People who inherit this same haplotype, this set of SNPs, are related because they literally are one in 2.1638944 × 10273.

Anyways, let’s fire up GenBank, specifically BLAST, a searching algorithm to help compare an unknown sequence to known ones in the database to show you who I match up with. If you want to retrace my steps, I’m here. I pulled down the database from the choose search set, to screen all the ‘nucleotide collection.’ This will take my sequence and screen it against all nucleotides in the database. If you also optimize for megablast, a more scrutinizing algorithm, you’ll know your match had to be dead on. Now, I gotta just cut and paste my sequence and hit BLAST.

A couple seconds later, I see a list of search results. At the top of which are alignments to known haplotypes from the mtDNA. I know my primers were designed to target mtDNA, and this confirms it. And if I see correctly, my mtDNA that I inherited from my mother is a 100% match to haplotype H*, H1, H4a. Using the following map, I can see where in the world this haplotype is specific to.

mtDNA Haplotypes

So, if you look hard you can see haplotype H is prevalent in Middle Eastern and European populations. I know I’m from the middle east, born there… and my family has a long history of living there. This test confirms some of my mtDNA is from that area of the world. Of course, if I screened for my haplotypes, I suspect I’d get a stronger match to middle eastern haplotypes.

Next time you read an asinine commentary on the validity of genetic ancestry testing, please refer back to this. Sometimes the science behind it isn’t explained, and I hope that misinformation can be adjusted. This sorta stuff can be abstract even to people with a doctorate and I don’t know if I explained it well, but hell, it is a start. People, especially professional anthropologists, need to make sure they know the difference between a gene and a haplotype, before they publicize that genetic ancestry testing is a scam. It works, these same principles are used everywhere… from the law to screen for lactose tolerance in populations…. to large scale pharmacogenomic tests. And just cause some capitalizing individuals want to make a profit off of people’s innate curiosity to see where they came from, doesn’t mean it is a scam!

One last thing, this quote from Small’s piece,

“If you want to know who you are, look in the mirror. Written on your face is countless generations that have survived to reproduce, and the only thing you can realistically do at this point is thank them and then move forward.”

… makes me want to puke. Way to go, Small. You really drive home your analytical, academic nature with this example of sappiness. These tests are ‘forward’ progress. Ugh.

Follow

Get every new post delivered to your Inbox.

Join 689 other followers