Archive for December 9th, 2007
Anthropologist Meredith Small says DNA testing is a scam
Here is Meredith Small, an anthropologist at Cornell University and a primatologist, who has focused her life work on observing behavior, writing a slam on DNA testing over at LiveScience. I don’t know how she gets the authority to call genetic ancestry testing a scam if she specializes in behavior.
But that’s really not the case, cause she has clearly shown, she doesn’t fully understand DNA testing. Blain Bettinger, the Genetic Genealogist, points this out to us. Here’s an example, where she sides with the opinions of Jonathan Marks,
“But, [anthropologist Jonathan] Marks points out, these companies are preying on the public because they simply don’t have enough comparative information to pinpoint a gene on a world map.”
Marks and Small, these genetic ancestry tests don’t isolate specific genes in populations. Instead, these tests mostly focus identifying haplotypes in the mitochondrial DNA which we inherit from our maternal lineage and, if we are male, our Y chromosomal DNA. Haplotypes are the unique composition of single nucleotide polymorphisms that we inherit as large fragments from our parents. They help classify us into our haplogroups. Once again, haplotypes are inherited as blocks. For example you can see how your segments of mtDNA matches up with other people who have similar haplotypes. If a population has a similar set of haplotypes, they are grouped in a haplogroup. This is how population genetics helps trace ancestry.
Some tests offer more resolution, in other words, they screen for more haplotypes, where as others are more general and can only identify down to a region of the Earth. Recently, in my PCR class, I sequenced part of my mitochondrial DNA. In the following post, I’m gonna describe to you what we can do with with this sequence and how we can tell where I came from. I hope Small and Marks will check this out.
After spitting in a tube, I isolated my DNA from my cells. Commonly, what happens next, is that a mix of primers, nucleotides, and polymerase enzyme is mixed into another tube with a small fraction of the DNA I isolated. The primers help polymerase identify and target the regions where haplogroups are, to amplify them. After running PCR, a chemical reaction where polymerase is activated and deactivated in multiple cycles, what I end up with is multiple copies of a set of haplotypes.
This is then sequenced. The sequence I get can be compared to a whole lot of other known sequences from people. If my sequence matches up with other people, we are more related than different. People from the same ethnicity tend to have similar sequences in sets of haplotypes. Here’s my sequence that I plucked out of the dLoop part of my mitochondrial DNA:
CAGATGTCGGATACAGTTCACTTTAGCTACCCCCAAGTGTTATGGGCCCGGAGCGAGGAGAGTAGCACTCTTGTGCGGGATATTGATTTCACGGAGGATGGTGGTCAAGGGACCCCTATCTGAGGGGGGTCATCCATGGGGACGAGAAGGGATTTGACTGTAATGTGCTATGTACGGTAAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGGGGTGGCTTTGGAGTTGCAGTTGATGTGTGATAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGTTTTGATGTGGATTGGGTTTTTATGTACTACAGGTGGTCAAGTATTTATGGTACCGTACAATATTCATGGTGGCTGGCAGTAATGTACGAAATACATAGCGGTTGTTGATGGGTGAGTCAATACTTGGGTGGG
Okay, so you’re asking, where in this string of nucleotides does it show where I’m from? This is were we must harness the comparative power of massive databases such as GenBank. Before we do, some people may think that this string is not significantly long enough to tell me about my heritage. It is… this sequence is 454 bases long, with 4 possibilities of bases per position, you can estimate that there are 4 454 different possibilities. People who inherit this same haplotype, this set of SNPs, are related because they literally are one in 2.1638944 × 10273.
Anyways, let’s fire up GenBank, specifically BLAST, a searching algorithm to help compare an unknown sequence to known ones in the database to show you who I match up with. If you want to retrace my steps, I’m here. I pulled down the database from the choose search set, to screen all the ‘nucleotide collection.’ This will take my sequence and screen it against all nucleotides in the database. If you also optimize for megablast, a more scrutinizing algorithm, you’ll know your match had to be dead on. Now, I gotta just cut and paste my sequence and hit BLAST.
A couple seconds later, I see a list of search results. At the top of which are alignments to known haplotypes from the mtDNA. I know my primers were designed to target mtDNA, and this confirms it. And if I see correctly, my mtDNA that I inherited from my mother is a 100% match to haplotype H*, H1, H4a. Using the following map, I can see where in the world this haplotype is specific to.
So, if you look hard you can see haplotype H is prevalent in Middle Eastern and European populations. I know I’m from the middle east, born there… and my family has a long history of living there. This test confirms some of my mtDNA is from that area of the world. Of course, if I screened for my haplotypes, I suspect I’d get a stronger match to middle eastern haplotypes.
Next time you read an asinine commentary on the validity of genetic ancestry testing, please refer back to this. Sometimes the science behind it isn’t explained, and I hope that misinformation can be adjusted. This sorta stuff can be abstract even to people with a doctorate and I don’t know if I explained it well, but hell, it is a start. People, especially professional anthropologists, need to make sure they know the difference between a gene and a haplotype, before they publicize that genetic ancestry testing is a scam. It works, these same principles are used everywhere… from the law to screen for lactose tolerance in populations…. to large scale pharmacogenomic tests. And just cause some capitalizing individuals want to make a profit off of people’s innate curiosity to see where they came from, doesn’t mean it is a scam!
One last thing, this quote from Small’s piece,
“If you want to know who you are, look in the mirror. Written on your face is countless generations that have survived to reproduce, and the only thing you can realistically do at this point is thank them and then move forward.”
… makes me want to puke. Way to go, Small. You really drive home your analytical, academic nature with this example of sappiness. These tests are ‘forward’ progress. Ugh.
