Anthropology.net

Beyond bones & stones

Archive for March 2008

What was the cause of the woolly mammoth extinction? Climate change or hunting?

with 4 comments

The following post doesn’t directly have much to do with anthropology. Indirectly, it sure does, especially to those out there that study human population expansions and the Pleistocene-Holocene transition or even anthropologists interested in prehistoric paleoenvironments and the context of how people were living and what they were doing during that time.

Anyways, this post is about a PLoS Biology paper. PLoS Biology is an open access journal that has just published a paper which investigates woolly mammoth extinction. Woolly MammothThe authors of the paper, “Climate Change, Humans, and the Extinction of the Woolly Mammoth,” ultimately conclude that both climate change and human hunting were critical factors in woolly mammoth extinction. Not a really Earth shattering conclusion, I know… but there has been some discussion whether or not climate change or human hunting was more impactful.

Right before the Holocene, the global climate was warming up. And most woolly mammoths died out during this time, the end of the Pleistocene (12,000 years ago). That’s what got many people to consider that warm temperatures may have driven the extinction of this cold-adapted species. But, the species had survived previous warming periods, and in places like St. Paul Island, Alaska and Wrangel Island they lasted up until 3,700 years ago. This is what got other people to think that the extinction of the woolly mammoth was due to the effects of human population expansion.

From the author’s summary,

“In this study, we combined paleo-climate simulations, climate envelope models (which describe the climate associated with the known distribution of a species—its envelope—and estimate that envelope’s position under different climate change scenarios), and a population model that includes an explicit treatment of woolly mammoth–human interactions to measure the extent to which climate changes, increased human pressures, or a combination of both factors might have been responsible. Results show a dramatic decline in suitable climate conditions for the mammoth between the Late Pleistocene and the Holocene, with hospitable areas in the mid-Holocene being restricted mainly to Arctic Siberia, where the latest records of woolly mammoths in continental Asia have been found. The population model results also support the view that the collapse of the climatically suitable area caused a significant drop in mammoth population size, making the animals more vulnerable to increasing hunting pressure from expanding human populations. The coincidence of the collapse of climatically suitable areas and the increase in anthropogenic impacts in the Holocene are most likely to have been the “coup de grâce,” which set the place and time for the extinction of the woolly mammoth.”

I’m really not clear about how the authors established their population models. I’ll do my best to review them, though. The authors compared and contrasted the population sizes to the climatic conditions. Curiously, their results differ as they increase the n, but they were able to calculate,

“that the most suitable geographic area available to woolly mammoths increased by 7.7 million km2 from the last interglacial, 126 ky BP, to 42 ky BP (from 0.3 to 8.1 million km2). There was a 0.5 million km2 decrease in the most suitable area between 42 ky BP and 30 ky BP periods, and then a 3.7 million km2 decrease between 30 ky BP and 21 ky BP (from 7.5 to 3.8 million km2). Finally, between 21 ky BP and 6 ky BP, there was a 2.9 million km2 decrease. By the 6 ky BP period, only 0.8 million km2 of the most suitable climatic conditions remained.”

This shows that with time, the available suitable habitats for the species reduced and did thus contributed to a reduction in woolly mammoth population sizes. Now the authors didn’t directly test the zooarchaeological record to directly correlate if human hunting or the side effects of human population expansion affected mammoth populations. But they did infer that their results of the incremental decrease in population sizes over time showed a “synergy” to the northward increase in human population densities during the Holocene.

So what about the mammoth groups in Alaska and the Arctic Ocean that persisted late after all the others died off? Their results actually show that these areas were largely unchanged by both climate and human impact. In fact, that climate change and human impacts were focused on mammoths in the northernmost land masses of Arctic Siberia and some arctic islands, “leaving them with nowhere to run away from extinction.”

    Nogués-Bravo, D., Rodríguez, J., Hortal, J., Batra, P., Araújo, M.B. (2008). Climate Change, Humans, and the Extinction of the Woolly Mammoth. PLoS Biology, 6(4), e79. DOI: 10.1371/journal.pbio.0060079

Written by Kambiz Kamrani

March 31, 2008 at 10:41 pm

More on Vajda’s Siberian-Na-Dene Language Link

with 23 comments

National Geographic News has just published an article about the recent symposium in Alaska regarding a possible connection between Yeniseic languages in Siberia and Na-Dene languages in the Americas. John Roach’s article, Siberian, Native American Languages Linked — A First, highlights the recent work of Edward Vajda, who defended his connection during the February symposium. Vajda goes deeper than cognate lists in his parallels, providing several corresponding grammatical systems, particularly verb prefix structure. Ket, his primary Siberian source, is the only living Yeniseic language (which remains highly endangered) and bears some striking grammatical similarities to Navajo. Yeniseic languages have a unique verb prefix system: unique enough that Vajda could not find a corresponding system throughout Northern Asia. Na-Dene was the closest family geographically with a similar system. Johanna Nichols, a groundbreaking Historical Linguist and Linguistic Anthropologist, attended the symposium and made comment. Roach quotes:

With the exception of the Eskimo-Aleut family that straddles the Bering Strait and Aleutian Islands, this is “the first successful demonstration of any connection between a New World language and an Old World language,” Nichols said.

Vajda has not yet published his findings, so the extent of his linguistic claims is not yet clear. However, based on Roach’s summary of his discussion, there are two major points of controversy. First, Roach states that Vajda found “several dozen” cognates. Whether or not the comparative method for linguistic reconstruction was used remains to be seen. Regardless, a cognate list under 50 seems a bit thin to solidify a connection at all, let alone begin reconstruction. Furthermore, the public at this point has no access to the words to assess their status as true cognates. Without a doubt, a consistent and corresponding element of grammatical structure is a strong argument for a common ancestor, but we must consider the systems of linguistic change, particularly sound change (which requires cognates), as a central factor.

A second point of controversy is the matter of depth: how long ago does the proposed connection date back? Vajda makes no direct claims, but states that this would be the oldest known language link if it corresponds to the late Pleistocene migrations evident in the archaeological record. Unfortunately, the field of linguistics currently has no reliable absolute dating techniques, and relative dating such as glottochronology, has been widely discredited. In this case, it seems the lack of cognates would help secure this relationship as an old one. If that were indeed the case, a volume of cognates would become evident in the reconstructions of Proto-Yeniseic and Proto-Na-Dene. Whether or not Vajda has taken this into consideration remains to be seen. At any rate, Nichols is not convinced of a 10,000 year-old connection:

“I don’t think there is any reason to assume the connection is [10,000 years] old … this must surely be one late episode in a much longer and more complicated history of settlement,” she said.

At this point it is very difficult to make any generalizations. Vajda has not yet published his findings, but merely opened the door to discussion on the topic. Until he does, the foundation of our support or criticism is unknown.

What is unique about the human arcuate fasciculus… and what does it have to do with language?

with 4 comments

Despite the fact that I’ve seen some really impactful primate related research lately, I’ve completely neglected updating Primatology.net with it. I can’t believe it has been almost three months since I’ve posted there! I should really resume posting there. Actually, I was considering putting up this following blog post over there, since it has to do with differences in neuroanatomy of the primate brain… but because these comparative studies are in the context of identifying specific architectural differences in the human brain related to language, I think posting it here is more fitting.

If you’re a reader of Neurophilosophy, you may have an idea of what research I’m referring too, the new Nature Neuroscience paper from James Rilling and team. Before I jump into this paper, “The evolution of the arcuate fasciculus revealed with comparative DTI,” please let me share another recent paper that gives some introduction about what I’m gonna talk about.

See earlier this month, Current Biology published a paper, “Communicative Signaling Activates ‘Broca’s’ Homolog in Chimpanzees,” where researchers not only confirmed that the Broca’s area as an important area of the human brain for language comprehension, but also chimpanzees have similar activity in the homologous area of their brains when communicative signals are produced or heard. The Broca’s area has long been thought to be one of the specialized functional areas of the brain for language comprehension. In fact was discovered almost 150 years ago by a physician named Pierre Paul Broca, who conducted an autopsy of patient with a speech deficit. Broca was able to determine the patient had a syphilitic lesion in the left cerebral hemisphere and identified this area as his namesake.

If you’ve heard anything about Broca’s area, it larger in the left hemisphere of the brain. Comparing activity levels between the two hemisphere, during language-related tasks, have shown the left hemisphere Broca’s area is more active. That’s due to the lateralization of the brain, which I’m sure you’ve heard of.

Anyways, the results of this study have important implications in figuring out the functional and structural differences of the human and chimpanzee brain. Why? Well, for starters, the linguistic abilities of humans have been thought to be unique to us for a while. This is a really big misconception because research on signing apes and other communicating animals, have begun to show us that we’re not alone in our abilities to symbolize information and exchange it by way of complex sound and gesture.

In order to investigate the differences of the activity between Broca’s areas in humans and related structure in chimpanzees, Taglialatela et al., put three chimpanzee subjects in PET and fMRI machines and stimulated to vocalize by putting treats just out of their reach. They then recorded the activity of the subjects would vocalize in frustration. They were able to see the very same the neuroanatomical structures associated with the production of communicative behaviors in humans, fire in chimpanzees.

Now, of course that doesn’t mean chimpanzees are gonna be reciting Shakespeare anytime soon. This leads me to the first paper I mentioned today, the one from Rilling and crew. Rilling et al., did a comparative anatomical study on the structure of arcuate fasciculus, a large white matter tract, in humans, chimpanzees and macaques. The arcuate fasciculus functions as a linker between Broca’s area and another language associated area of the brain, Wernicke’s area. The researchers used diffusion tensor imaging (DTI), a type of noninvasive medical imaging that’s a lot like MRI but it compares and contrasts the local characteristics of water diffusion within tissues.

While the arcuate fasiculus of the rhesus macaque, the chimpanzee, and the human linked up to the frontal cortex — including with Broca’s area, it was observed that the human arcuate fasiculus is much larger. It more spreads deep into the middle temporal lobe, leaving the classical Wernicke’s area. In chimps, the arcuate fasciculus made very superficial connections to the temporal cortex regions homologous to Wernicke’s area. Macaques showed a much lower extend of this integration. Rilling commented,

“We know from previous functional imaging studies that the middle temporal lobe is involved with analyzing the meanings of words. In humans, it seems the brain not only evolved larger language regions but also a network of fibers to connect those regions, which supports humans’ superior language capabilities.”

This following diagram was published in Rilling et al.’s paper and illustrates their results:

A Diagram of the arcuate fasciculus of Humans, Chimps, and Macaques

So from these two papers, the evolution of specialized language areas maybe active in both chimpanzee and human brains but as the human brain diverged from other primate counterparts, major re-wiring at the arcuate fasciculus accompanied the massive expansion of brain size. Ultimately the area that is associated with understanding word meaning, Wernicke’s area, has been strongly connected with Broca’s area.

    Rilling, J.K., Glasser, M.F., Preuss, T.M., Ma, X., Zhao, T., Hu, X., Behrens, T.E. (2008). The evolution of the arcuate fasciculus revealed with comparative DTI. Nature Neuroscience DOI: 10.1038/nn2072
    TAGLIALATELA, J., RUSSELL, J., SCHAEFFER, J., HOPKINS, W. (2008). Communicative Signaling Activates ‘Broca’s’ Homolog in Chimpanzees. Current Biology, 18(5), 343-348. DOI: 10.1016/j.cub.2008.01.049

Four Stone Hearth 37 – The Pulp SciFi Edition @ Hot Cup of Joe

leave a comment »

There’s a brand new – and very stylish – edition of the anthropology blog carnival, Four Stone Hearth, which should be visible in the night sky, depending on local weather conditions – but if not, you’ll definitely be able to see and read it by clicking on Hot Cup of Joe, where there is the usual mix of very good contributions from around the anthro blogosphere.

Next up on April 9th will be Julien over at A Very Remote Period Indeed, so in the meantime many thanks to Carl for putting it all together this time around.

Written by Tim Jones

March 26, 2008 at 10:55 am

Posted in Announcement, Blog

Four Stone Hearth 37, Wed. March 26th – Call For Submissions

leave a comment »

Hot Cup of Joe will be the venue for the upcoming 4SH, this Wednesday, March 26th, so if you’d like to send something along, you can do so via submit@fourstonehearth.net, or directly to Carl at cfeagans AT gmail DOT com, with FSH in the subject line.

Written by Tim Jones

March 24, 2008 at 12:12 am

Posted in Announcement, Blog

I Love Lucy

with 6 comments

Major kudos goes out to Simon of HENRY, who found this awesome shirt:

I Love Lucy Tshirt

Even though that ain’t Lucy’s skull — she wasn’t found with a complete one… I still want one on these shirts!

Actually, I drew this skull in 2006!

Drawing of a Australopithecine Skull

Written by Kambiz Kamrani

March 20, 2008 at 9:22 pm

A Multivariate Analysis of Orrorin tugenensis and the Ancestry of Bipedalism

with 5 comments

Tomorrow’s issue of the Science will host a reinvestigation of the famous (or infamous?) Orrorin tugenensis. The study, “Orrorin tugenensis Femoral Morphology and the Evolution of Hominin Bipedalism,” comes from William Jungers and Brian Richmond. Their shtick is that their results indicate Orrorin’s bipedality was like that of early Australopithecus.

This conclusion, albeit not too novel, directly challenges Brigitte Senut et al., who published the anouncement of Orrorin tugenensis in 2001. In that paper, “First hominid from the Miocene (Lukeino Formation, Kenya),” Senut and crew lay the foundation that Orrorin is an ancestor of modern humans because proximal femur is really different from Lucy’s, and the overall proportions of the head of the femur to the shaft resemble that of humans and not other early human ancestors. Orrorin is really old, like 6 million years old.

Of course, that was an outrageous claim. No one really doubted the bipedality… Femora of early hominids, Orrorin, and humansBut looking at the bone, it really looked like Australopithecus. It was the same size as a chimpanzees too. Femora of Homo are longer. Furthermore, the other associated Orrorin fossils, like the canines, were like chimpanzees. So it is no surprise she got a lot of flak from people. It reeked of bias, as if Senut had this idea that there’s no way Australopithecus coulda been ancestral to humans and the first fossil she found that showed otherwise would be her cash cow. She even named it after the Tugen word for “original man.”

Criticism flocked, and Senut dug herself in a deeper hole when she was a part of the team that analyzed the internal morphology of one of the Orrorin femora with computed tomography (CT). I remember reading the 2004 paper, “External and Internal Morphology of the BAR 1002’00 Orrorin tugenensis Femur.” According to this paper, the CT scans of BAR 1002’00 revealed that the top of neck of the femur was thinner than the bottom of the neck of the femur. This indicates more structural integrity on the bottom, where gravity would most affect a bipedal organism. This trait, “approached the condition in later hominids.”

This fancy CT study didn’t do much convincing. The most prominent critique came from Ohman et al., who slammed Senut for originally gluing the fractured fossil right at the very position where one coulda made an accurate analysis of the cortical thickness without having to do crazy high tech obfuscation. Ohman and crew also argued that the fossilization process thickened the cortices, and that a simple X-ray woulda been more informative than very pixelated CT images. The response to Ohman et al. was pitifully, resorting whining. Everything remained quiet for about three years. Sunet and Pickford as well as some Japanese colleagues published a paper investigating body mass, and stature estimates of Orrorin last year. But it didn’t make that much of a buzz.

So in summary, it is agreed by many that Orrorin was bipedal, but just the degree it diverged in relation to other early hominids hasn’t widely accepted. Unfortunate for Senut, that was just one lemon she couldn’t hustle.

Fast forward to today, where Jungers and Richmond say their findings indicate that the Orrorin belongs to very early human ancestors, and that upright walking is one of the first human characteristics to appear in our lineage, right after the split between human and chimpanzee lineages.

How they went about doing it was by a multivariate analysis of measurement from the outside of the femur. The outside folks. Where would there be the most restructuring of femur for bipedalism? On the outside of the femur or on the inside? Think about it for a second… If you’re still confused a bit, just ask a structural engineer, the thickness of a hallow structure would need to increase as it bears more weight. As early humans became more bipedal, more weight was distributed on the femora compared to quadrupedal locomotion, where weight is distributed between four limbs.

That being said, I’m really curious to read just what they found about the measurements of the outside of the Orrorin femur. Why didn’t they just do an X-ray? A simple 2 view X-ray costs $250 or so.

One last thing, this National Geographic News article quotes Ian Tattersall, curator of the division of anthropology at the American Museum of Natural History, saying,

“If you were going to predict what an early hominid would look like six million years ago, you’d say [it looks] much more like the Australopithicines than like Homo… “

Seems like Tattersall is flipping the stance he took on Orrorin‘s place in the ancestry of humans. In 2oo2, he’s quoted in an Ann Gibbon’s piece, “In Search of the First Hominids,”

“As a working hypothesis, I think [Senut et al.] are correct, although they don’t have the most diagnostic set of fragments.”

    Galik, K. (2004). External and Internal Morphology of the BAR 1002’00 Orrorin tugenensis Femur. Science, 305(5689), 1450-1453. DOI: 10.1126/science.1098807
    Nakatsukasa, M., Pickford, M., Egi, N., Senut, B. (2007). Femur length, body mass, and stature estimates of Orrorin tugenensis, a 6-Ma hominid from Kenya. Primates, 48(3), 171-178. DOI: 10.1007/s10329-007-0040-7
    Senut, B. (2001). First hominid from the Miocene (Lukeino Formation, Kenya)Premier hominidé du Miocène (formation de Lukeino, Kenya).. Comptes Rendus de l’Académie des Sciences – Series IIA – Earth and Planetary Science, 332(2), 137-144. DOI: 10.1016/S1251-8050(01)01529-4

Correlating genetic and morphological evidence to pinpoint a divergence time for Neandertals and modern Humans

with 5 comments

A couple days ago, I introduced a new paper by Weaver et al. which continues investigating the effect of genetic drift in modern human vs. Neandertal craniofacial differences. I didn’t have access to the paper then, but now I do and I wanted to share my thoughts and ideas of it with you.

The premise the authors worked upon is through using drift in sequences of microsatellites as a template to estimate the effect of drift in the morphological differences in Neandertal and modern human craniofacial traits. What are microsatellites? I’ve defined this term a million times, so I’ll be brief. Microsatellites are simple repeats of DNA sequences. They aren’t really complex in pattern and when they are found, they indicate an increased rate of mutation compared to other neutral regions of the genome.

To understand how the authors correlated variation microsatellites to variations in morphology, let’s first try to understand how microsatellites are formed. Effectively microsatellites are mistakes, but they aren’t necessarily deleterious. During DNA replication or recombination, slippage can occur, especially in stretches of a simple pattern, like say AAAAA. How? Imagine portion of double stranded DNA, with a sequence like this:


GATCTATTAGGAAAAATTAGCAGA
CTAGATAATCCTTTTTAATCGTCT

After the two strands are split apart with helicase, and the two ends meet back up, it could slip and mispair. In this case, it would end up like this:

GATCTATTAGG AAAAATTAGCAGA
CTAGATAATCCTTTTT AATCGTCT

Where the space is where mispairing occurred… on the ends of the AAAAA, since a significant stretch of the DNA, the other AAAA, were perfectly paired. Thus, if this mistake is overlooked by repair mechanisms, a polymerase may come in and extend the space with a complementary A and ultimately extending the original AAAAA into a longer stretch, like AAAAAA or longer. After many generations, this stretch can end up looking like so:

GATCTATTAGGAAAAAAAAATTAGCAGA
CTAGATAATCCTTTTTTTTTAATCGTCT

When this sort of phenomenon happens it is called genetic drift. It is random and most often a mistake. Like I mentioned above, rarely are these mutations deleterious. Typically, they are neutral, meaning that they offer no advantageous nor deleterious traits. They persist, and can even get longer over generations. Sometimes they even get shorter.Microsatellites act as good identifiers to figure out relatedness and population structure. How? If one could find out how often changes in microsatellite sequences occur on average, one could begin to begin to make a molecular clock of sorts to calculate temporal rates of neutral evolution.To correlate drift in microsatellites as a framework to understand the impact and temporal mode of drift in the morphological differences in Neandertal and modern human craniofacial traits, the authors had to adapt a mathematical algorithim that I just eluted to called the divergence time estimator (TD). Rather than confusing TD used in molecular evolution, the authors propose a new name for their clock, PTD, standing for phenotypic divergence time estimator.It is critical to understand this equation because the entire study is founded upon applying morphological measurements in modern humans and Neandertals to this clock. I’ll break down all the variable as best as I can, but the final equation the authors give to us for PTD is:

Phenotypic Divergence Time Estimator

Your mind might be spinning just looking at this equation, I know it immediately sent shivers down my spine of the stuff I had to deal with in multivariable calculus. Wrought with fear, I glanced over this part of the paper at first pass, but under some more scrutiny I realized this really is all algebra… totally doable if we just understand what the variables and constants are.

So from the top, x1 and x2 are the means of population 1 and 2. The authors don’t really define what the mean is, I am assuming it is population size. h2σ21 and h2σ22 are narrow-sense heritability for the measurement and the phenotypic variances for population 1 and 2. Basically the degree of how heritable and variable are these phenotypic traits. V0 represents the additive genetic variance in the ancestral population before Neandertal and modern human lineages went their own ways. Setting V0 to 0 yields the maximum estimate of divergence time.

On the denominator we see m, which represents the mutation parameter. I’m not too sure what this is, but since it is represented twice, I think of it as a constant. Since it is in the denominator and we want to figure out the rate of drift, my best guess is the rate of neutral variation of traits based off of the divergence time estimator (TD) from mircosatellites. σ2P, represents within population phenotypic variance. I’ve already reviewed what h2 is, but to rehash it is the narrow-sense heritability measurement.

If I’m correct with my understanding of the variables, after integrating all them together, I can see that the numerator factors in differences in population size, heritability, and between population variation. The denominator factors in the mutation rate, and within population variation and inheritance.

The archaeological and fossil record tell us that the population sizes of pre-divergence of Neandertal and modern human peoples from several hundred thousand years ago were relatively small. Therefore, initial generations, after the divergence, would also be small and homogeneous both genetically and phenotypically. This assumes that punctuated equilibrium was not a factor in the speciation modern humans and Neandertals. As time progressed and each population grew in size, mutations are expected to increase and introduce variation until another equilibrium is reached.

Personally, I have a lot of questions with this portion of the paper. I understand the equations, but I don’t quite grasp the assumptions one has to make to consider these equations applicable. I can really use some clarification, so feel free to chime in.

My concerns stem off of how the authors corrected for fluctuations in population size? Both Neandertal and modern human populations were not gradually growing. There were waxing and weaning moments in population growth for both species. Futhermore, Neandertals and human populations weren’t both growing and reducing at the same times and rates, which would alter the self adjusting equilibrium the authors operate on.

The 37 different cranial measurementsWith a reduction in population size, genetic and morphological variation are also lost. The loss in diversity will take with it neutral diversity as well as negative diversity, like deleterious traits. Some positive diversity will also be lost, too… not all and not as much as losses in negative and neutral diversity. But overall diversity, both from drift and in selection, would be greatly reduced as populations dwindled in size. What I’m trying to get at is, neither selection nor drift can be solely responsible for the differences between Neandertals and humans, because both are filtered out as population sizes grow and reduce.

My confusions aside, the authors took this neutral phenotypic evolution model of theirs and applied it to an recent data set that showed Neandertals and modern humans seem to evolving neutrally in 37 different cranial measurements. The 37 different measurements are illustrated to your right. I’ve plucked this from the article. I must say they are very thorough, much more thorough in measurements than this upcoming paper on Homo floresiensis.

Plugging in the 37 measurements from 2,524 modern human skulls from 30 globally distributed populations and 20 Neandertal specimens into their equation resulted in the divergence time of modern humans and Neandertals to be 311,000 years ago, assuming mutation drift equilibrium. Under this assumption the 95% confidence interval is actually really wide… between 182,000 – 466,000 years ago. This is a huge time span when considering the divergence time of these two Homo species. It raises questions the accuracy of thinking that drift was the only thing at play here. Calculating for the the maximum divergence time yields a narrower 95% confidence interval, of 308,000 – 592,000 years ago divergence time, which is better but still doesn’t resolve how the authors overcame in different fluctuations the different population sizes.

All that aside, these dates extracted from morphology confirm dates that Noonan and colleagues figured out from sequence analysis of ancient Neandertal DNA in 2006, which is really remarkable because it has been hard to make these two lines of evidence speak to one another.

Not that I wanna draw out this post anymore, but I think I should really address why is this important as a prize for you drudging along with me so far. As you may know, there’s quite a lively debate with how ancient Homo species were replaced once modern Homo sapiens started flocking out of Africa. There’s one hypothesis that advocates a total replacement of ancient Homo with modern humans, while another hypothesis that raises the possibility ancient Homo integrated with modern humans. This paper shows that it is possible to look at the phenotypic differences between Homo sapiens and Homo neanderthalensis and see that they really don’t show evidence of admixture, in fact it is possible to trace back the time at which these phenotypic differences began to radiate. Anyways, for a more thorough introduction into the importance of this paper, read Alex’s blog post on it.

In the meantime, I am gonna celebrate Nooruz. Happy New Year everyone!

    Weaver, T.D., Roseman, C.C., Stringer, C.B. (2008). Close correspondence between quantitative- and molecular-genetic divergence times for Neandertals and modern humans. Proceedings of the National Academy of Sciences DOI: 10.1073/pnas.0709079105

An upcoming study on Homo floresiensis says they are a separate species

with 5 comments

Another PNAS study to share with y’all, this time I caught the announcement via ScienceNOW. ScienceNOW says the paper is out today, but I can’t find it. Go figure. So all I got to run with is this news report.

The authors of this paper are Adam Gordon, Lisa Nevell, and Bernard Wood. They compared the size and shape of other hominid skulls with that of Homo floresiensis. They conclude that LB1LB1,

“from the island of Flores is unlikely to be a shrunken or diseased Homo sapiens, as some have argued, and that its ancestry may instead trace back to ancient Homo species in Africa.”

Two weeks ago we read a very flawed article that concluded Homo floresiensis was nothing more than a bunch of endocrine-ly challenged modern humans. There’s been a so much back and forthing on whether or not Homo floresiensis is a unique species that is has become tiresome to even keep up with the arguments. Sometimes it feels like ego is at more at stake here than really figuring out human evolution.

This new study seems to want to simplify things. From the news article,

“The researchers gathered published data on six measurements of skull shape, such as the height of the cranium and the forward jut of the jaw, on 2524 modern humans, 30 ancient hominids of various species, and the hobbit. Statistical analysis showed that the hobbit skull most resembled H. erectus skulls from Africa and Dmanisi, GeorgiaD2700, dating as far back as 1.7 million years ago. Then, because the skull’s tiny size presumably influences its shape in certain ways, the researchers did a second analysis considering the effects of scale–in effect asking what type of hominid, if shrunk to hobbit size, would best match LB1. In this part of the study, LB1 most resembled African H. habilis, the most primitive and small-brained species of our genus, also dated to about 1.7 million years ago.

“This is particularly exciting because … it suggests that we really do have a hominin lineage that split off from our own as much as 1.7 million years ago, yet persisted up until the time when modern humans started peopling the Americas,” says Gordon.”

To recap on some osteological goodness, the six measurements are as follows:

  1. Glabella to Opisthocranion, a measurement of the maximum length of the skull. That’s from the front to the back of the skull.
  2. Basion to Bregma, a measurement of the of the maximum height of the skull. That’s from the base to the very tip top point of the skull.
  3. Euryon to Euryon, a measurement of the maximum breadth of the skull. That’s from one side to the other side.
  4. Nasion to Basion, a measurement of the length of the base of the skull.
  5. Basion to Prosthion, a measurement of the distance between the base of the skull to the tip of the maxilla (upper jaw).
  6. Biasterionic breadth, a measurement I haven’t heard of but looks like it is the width of the base of the skull.

I’m gathering that the authors took these multiple measurements and did a phylogenetic analysis. I am getting this from what was indicated in the above excerpt, they compared a lot of modern humans, fewer hominids of various species, and the hobbit. I don’t have the article to confirm this methodology, but I can only assume that is what they did to figure out LB1 is similar to Africa and Dmanisi Homo erectus, even H. habilis in some regards, based off of the measurements.

But, if you have read this paper, “Remains of Homo erectus from Bouri, Middle Awash, Ethiopia,” you should know how reconstructing phylogeny with cladistic analysis between early Homo species is hard and rather inconclusive. We know general trends and large scale similarities and differences, but when it gets to nitty gritty things, the paltry calvarial evidence for big differences between the African and Asian fossils make it really difficult to say Asian Homo erectus was that much different from African Homo erectus. Instead, it is much safer to say that Homo erectus existence spanned large time frames. And that even with a 1.2 million year old difference in time, Homo erectus from Africa to Asia was pretty much the same thing.

For that reason, I wonder how LB1 can be like Homo erectus… especially a really old African erectus as indicated in the report? Above, I put a lateral view of LB1 as well as a lateral view of a Dmanisi Homo erectus (D2700), one that the authors say LB1 resembles. Just by eyeballing the differences between the two skulls we can see that D2700 is much longer, and has a big difference in the basion to prosthion length.

If we take into consideration the works of Asfaw et al., there aren’t many differences between African and Asian Homo erectus that can be figured out thru cladistics. And Asian Homo erectus persists in the record into much more recent times. So, why isn’t LB1 related to an Asian Homo erectus? They should be synonymous, no? What is particularly African erectus about LB1?

Furthermore, how can a tiny hominid like LB1, with a brain half the size of Homo erectus and an antiquity of only 18,000 years old, be compared to one of the root species of Homo? Some of the earliest Homo had brain sizes of 900 or so cc. LB1 had a brain size of 440 cc. Big difference here folk. The news article reports that they ‘shrunk’ the proportions of other early Homo skulls down to LB1′s size to compare. Is that even a valid way to compare? The very fact that LB1 is distinct is its size, so scaling down comparative measurements seems flawed because we’re comparing apples to oranges watermelons here. You can’t just scale down a watermelon down to the size of an apple and begin to start concluding their similar.

I’m not alone scratching my head over this. Christoph Zollikofer, also has some problems with this cladistic approach. He says the six measurements aren’t enough to

“capture the complexities of skull shape, a concern shared by others. In his view, this kind of analysis might cluster together skulls that are actually distinct. Depending on the species included, says Zollikofer, the approach could end up finding similarities between LB1 and chimpanzees.”

I guess we all gotta wait until PNAS puts out this paper.

    Asfaw, B., Gilbert, W.H., Beyene, Y., Hart, W.K., Renne, P.R., WoldeGabriel, G., Vrba, E.S., White, T.D. (2002). Remains of Homo erectus from Bouri, Middle Awash, Ethiopia. Nature, 416(6878), 317-320. DOI: 10.1038/416317a

Written by Kambiz Kamrani

March 17, 2008 at 9:04 pm

Weaver, Roseman and Stringer back at it with Neandertals, Natural Selection and a time of divergence

with 3 comments

Today’s early issue of PNAS includes a paper by Tim Weaver, Charles Roseman and Chris Stringer who revisit the chance or natural selection issue in regards to Neandertal and modern human speciation. You may remember they published a paper in August of 2007, in which they basically concluded that natural selection really didn’t have anything to do with why Neandertals are so morphologically different. According to these older results, there really hasn’t been a real benefit to their really robust skulls with large noses, rather those traits just sprung about by chance. That goes against a lot of adaptionists hypotheses that proposed Neandertal robusticity has been selected in response to the cold and harsh environment they lived in.

The new paper is titled, “Close correspondence between quantitative- and molecular-genetic divergence times for Neandertals and modern humans,” and Weaver et al. apply their older data set of, “37 standard cranial measurements collected on 2,524 modern humans from 30 globally distributed populations and 20 Neandertal specimens” to some improved algorithms. The abstract indicates they built upon the older model, that used changes in microsatellites as a framework for understanding selection versus random genetic drift. With this ‘clock’ of sorts, they were actually able to present a divergence time of neutrally evolving morphological measurements.

I don’t have access to the PNAS paper just yet. For some odd reason my institution’s library access is always a day behind, so if anyone would be so kind enough to email me the paper, nevermind I got it. Anyways, I’ll be more than happy to figure out how they were able to use a ‘reverse’ molecular clock. See usually molecular clocks are calibrated on the fossil record, but in this situation it seems like it is the opposite. It seems the authors were able to figure out a clock for random genetic drift and correlate that to morphological traits.

They were able to pluck out two dates, which differ by around 120,000 years because of difference between ‘within-population variation.’ The low end of the speciation time for Neandertals is at 311,000 years ago with a high end at 435,000. The confidence intervals for the 311,000 year old date are pretty gnarly, but in general this date is beginning to fall much more in line with the genetic data. Anyways it looks like a good paper, but I really don’t know the details, if someone out there wants to send me the PDF, please do. Got it.

    WEAVER, T., ROSEMAN, C., STRINGER, C. (2007). Were neandertal and modern human cranial differences produced by natural selection or genetic drift?. Journal of Human Evolution, 53(2), 135-145. DOI: 10.1016/j.jhevol.2007.03.001

Written by Kambiz Kamrani

March 17, 2008 at 4:09 pm

Follow

Get every new post delivered to your Inbox.

Join 691 other followers