Archive for July 2008
Paleoanthropologist Louise Leakey’s TEDtalk
Every year TED invites esteemed academics, thinkers, doers, entrepreneurs, etc. to give an exclusive 15-18 minute long talk about what they do and why it is important for the rest of the world. I’ve shared one of these talks with you before, Zeresenay Alemseged’s. In this year’s conference, Louise Leakey, of the Leakey family lineage of paleoanthropologists, talks about her life history and the importance of finding fossil hominids.
She emphasizes how hard it is to find fossils, her view of hominid diversity, and her accounts of when Turkana Boy was found and excavated when she was 12 years old. She also weaves in points about how our population growth needs to be moderated. If you got 15 minutes to spare, I recommend watching it to know a bit more about how fossils are found and the Leakey legacy.
Ancient Chilean Chicken May Not Be Of Polynesian Origin
It is coincidental that a regular Anthropology.net commenter, Terry, just posted a comment about last year’s study on the origins of early American chicken because PNAS published a new paper on this topic today. Razib pointed out the link to the new paper, “Indo-European and Asian origins for Chilean and Pacific chickens revealed by mtDNA.” This current study challenges claims of last year’s paper, the one that suggested that chickens were first introduced into South America by way of seafaring Polynesians, before the arrival of Spanish chickens in the 15th century.
After sampling the mtDNA from 41 native Chilean chickens and comparing the sequences to over 1000 modern domestic chickens from around the world, including the previously published sequences from Polynesian and Chilean chicken bones, the researchers concluded that ancient chickens from Easter Island may represent mtDNA signatures (haplotypes 145 and 148) of early Polynesian chicken transport, but ancient Chilean chickens do not. In fact, the pre-Columbian chickens have haplotype 8, which is the single most common chicken haplotype found around the world.
This indicates that pre-Columbian chickens were not exclusive to Polynesian peoples. Alan Cooper, one of the authors of this paper and the director of the University of Adelaide’s Australian Centre for Ancient DNA, said,
“This sequence would undoubtedly have been common in the early Spanish chickens, and therefore provides no evidence of Polynesian contact. So while we can say the [haplotype 8] chicken was popular amongst early Polynesian voyagers, we certainly can’t use it as evidence for trade with South America.”
- Gongora, J., Rawlence, N.J., Mobegi, V.A., Jianlin, H., Alcalde, J.A., Matus, J.T., Hanotte, O., Moran, C., Austin, J.J., Ulm, S., Anderson, A.J., Larson, G., Cooper, A. (2008). From the Cover: Indo-European and Asian origins for Chilean and Pacific chickens revealed by mtDNA. Proceedings of the National Academy of Sciences, 105(30), 10308-10313. DOI: 10.1073/pnas.0801991105
Why There Is Such A High Percentage Of Amerindian mtDNA And European Y-Chromosome Signatures In The Caribbean
I have family living in the Caribbean, they specifically reside on the island of Grenada. And I regularly go down to visit them. Given that the many islands in Caribbean functioned as pit stops for the slave trade, I’ve been curious about the demographics, history, and genetics of Grenada. Based off of cursory observations, the majority of the population is of African decent — but there are people from Europe, India, the Middle East and East Asia living there as well. I’ve seen very few mix, marry and reproduce. Instead, most choose to live in their respective groups.
Prior to European contact in 1498 by Christopher Columbus, Grenada was inhabited by Carib and Arawak peoples, both originating from Central/South America. The Arawak preceded the Caribs. It is believed they first occupied the Caribbean islands somewhere around 100-200 A.D. The Caribs came around much later — about 100 to 150 years before Columbus. They were very hostile compared to the Arawak and killed many Arawak. Those who were spared were enslaved. The Caribs also prevented settlement of Grenada by Europeans for 150 or so years.
The English tried and failed in 1609. The French first gave it a shot in 1638 and biffed it. It was not until 1650 that another French attempt, this time from a nearby island, Martinique, established a permanent presence in Grenada. Not surprisingly, the Carib did not welcome the French colony. They launched a series of battles and lost. They were determined not to submit to French rule and ultimately the last surviving Caribs jumped to their death off a precipice in the north of the island.
Some of the other islands in the Caribbean, like Puerto Rico and Cuba, share a similar history. A primary population, of Arawaks/Taínos displaced by another indigenous population — ultimately to be eradicated by European contact and pathogens. One would suspect that there was not much admixture because of the rapid mortality.
Today, Dienekes shared a paper investigating the genetic diversity of modern Cuba — an island that originally had Arawak people, then Ciboney people, and ultimately African and European slaves and colonists. There are some pretty surprising results.
The paper, “Genetic origin, admixture, and asymmetry in maternal and paternal human lineages in Cuba,” is published in the open access journal BMC Evolutionary Biology. The authors of the paper sequenced and analyzed the HSV I and 5 SNPs in the mitochondrial genome of 245 Cuban individuals. They also seuqenced and analyzed 40 SNPs on the Y-Chromosome of of 132 Cuban males. Their results indicate that the,
“Native American contribution to present-day Cubans accounted for 33% of the maternal lineages, whereas Africa and Eurasia contributed 45% and 22% of the lineages, respectively. This Native American substrate in Cuba cannot be traced back to a single origin within the American continent, as previously suggested by ancient DNA analyses. Strikingly, no Native American lineages were found for the Y-chromosome, for which the Eurasian and African contributions were around 80% and 20%, respectively.”
Razib thinks that the the high percentage of Native American footprint in the modern day Cuban mitochondrial gene pool is because admixture occurred very early on. Makes sense, early European conquistadors and colonists that inhabited Cuba, were most likely straight males interested in the triumph of new land, riches, and flesh.
But, does this genetic analysis of Cubuan populations have any tangents to other Caribbean islands? Razib linked up another paper, published in American Journal of Physical Anthropology, which investigated Puerto Rican mitochondrial diversity. The authors of the paper, “Reconstructing the population history of Puerto Rico by means of mtDNA phylogeographic analysis,” sequenced and analyzed only the mitochondrial genome of 800 individuals. They were able to fish out that 61.3% of Puerto Rican mtDNA comes is of Amerindian ancestry. Sub-Saharan African and West Eurasian mitochondrial signatures were found in much less degrees, 27.2% and 11.5% respectively.
Both studies show that on these two islands, there is a substantial mitochondrial contribution from indigenous pre-Columbian populations in modern day populations. Dienekes suggests that the reason why there isn’t a substantial Y-chromosome contribution is that Y chromosome diversity within an already settled territory was wiped out, citing that, “new pathogens or a technological differential between colonists and natives,” are two possibilities.
I disagree with the first half of his statement, new pathogens are for the most part indiscriminate of sex. Technological differences, however, could have manifested in less indigenous males, especially after battles. That, coupled with the accounts of rape and pillage by European settlers, it seems like a more understandable reason to why we see such high Amerindian mitochondrial and European Y-chromosome signatures.
- Mendizabal, I., Sandoval, K., Berniell-Lee, G., Calafell, F., Salas, A., Martinez-Fuentes, A., Comas, D. (2008). Genetic origin, admixture, and asymmetry in maternal and paternal human lineages in Cuba. BMC Evolutionary Biology, 8(1), 213. DOI: 10.1186/1471-2148-8-213
- MartÃnez-Cruzado, J.C., Toro-Labrador, G., Viera-Vera, J., Rivera-Vega, M.Y., Startek, J., Latorre-Esteves, M., Román-Colón, A., Rivera-Torres, R., Navarro-Millán, I.Y., Gómez-Sánchez, E., Caro-González, H.Y., Valencia-Rivera, P. (2005). Reconstructing the population history of Puerto Rico by means of mtDNA phylogeographic analysis. American Journal of Physical Anthropology, 128(1), 131-155. DOI: 10.1002/ajpa.20108
Can There Be A Synthesis Between Cultural And Biological Evolution?
Language is a product of culture. Or is it? Which came first — language or culture? That’s like asking if the chicken or the egg came first. But cultural behavior has been documented in animals who do not have language systems, like gorillas who have intricate systems of processing plants. Richard Byrne summarized this behavior,
“Gorillas do not make tools in the wild… but several of their food-processing skills consist of highly structured, multi-stage sequences of bimanual action, hierarchically organized and flexibly adjusted to plants of highly specific local distribution and these abilities are near-ubiquitous among the local population. In terms of intricate complexity, gorilla plant-processing actually exceeds anything yet described in chimpanzees, unless tool-use per se is taken to be intrinsically more complex than non-tool-use. Gorilla, like Pan and Pongo, apparently sometimes relies for its survival on elaborate, deft and intricate feeding skills that are highly unlikely ever to be discovered by a solitary individual.”
This example is just one of many. It documents that culture can be created, persist and change without language. It does so through mimicking and augmentation. So it is generally assumed that culture came first, and language emerged as a system of formalized symbols, sounds, gestures used a means of communicating culture.
Why am I mentioning this at all? Well, we’ve seen, read and reviewed a couple of recent studies investigating cultural evolution and patterns in linguistic diversity. Most notably is the paper by Atkinson et al., where Simon and team showed that language evolves in bursts. Additionally, Deborah Rogers and Paul Ehrlich showed that cultural things have functional and symbolic elements, the former of which is under naturally selective pressures.
Despite these advances, there are some who still think that culture and everything related with culture is nothing but noise. I don’t know where they get this idea from. Even John Herschel and Charles Darwin understood that extant ‘languages descended from a common ancestor,’ and, ‘the formation of different languages and of distinct species, and the proofs that both have been developed through a gradual process, are curiously parallel.’ This observation was made before the publication of The Voyage of the Beagle and without a doubt helped lay the framework for the theory of evolution. The irony is that these vocal objections come from someone who specializes in studying material culture.
Anyways, I digress. John Whitfield, a science writer and blogger behind El Gentraso, has published a feature in the latest issue of the open access journal PLoS Biology where he summarizes “… the Curious Parallel of Language and Species Evolution.” As anthropologists, we should appreciate the remarkable tangents between the dynamics of linguistic change and biological evolution. Because of these similarities, it is possible to use tools and frameworks used in studying biological evolution to study how language changes… even how cultures evolve. Furthermore, it is very possible that we may soon see a synthesis of theories, one that folds in both both biological and cultural evolution.
Whitfield summarizes research by Simon Kirby, which I didn’t know about but find fascinating.
“Kirby has asked subjects to learn a nonsense language and then teach it to new subjects, and so on. He found that the randomness quickly became regularized, as people unconsciously shaped words into something easier to remember and use, and devised rules to come up with words for things they hadn’t seen. Such a process may be at work in the spontaneous emergence over the past few decades of two sign languages—Nicaraguan Sign Language and Al-Sayyid Bedouin Sign Language. Each of these has moved rapidly from a system of gestures to a fully fledged language with conventions for grammar and sentence structure. Kirby plans to use them as a test bed for his ideas about how structure in language can rapidly emerge.”
In the piece, Whitfield also got to ask Mark Pagel‘s what his thoughts are with synthesizing ‘the two’. Pagel is an evolutionary biologist. He was one of the coauthors of the paper with Simon Greenhill and Atkinson. He’s also published an earlier paper with Atkinson titled, “Frequency of word-use predicts rates of lexical evolution throughout Indo-European history.” Pagel responded saying,
“Languages are extraordinarily like genomes. We think there could be very general laws of lexical evolution to rival those of genetic evolution.”
Alex Mesoudi agrees. He told Whitfield,
“If there’s a model system for cultural evolution, then probably the people working on language have got it, because there’s so much data… Cultural change and biological change share the same fundamental properties of variation, selection and inheritance.”
William Croft is a bit more cautious but also understands that,
“these are two different instantiations of a general theory of evolutionary change. These are early days, but such a theory will give us insights that you can’t get just by looking at one domain.”
So what do you think — is it possible to synthesize the two? Or do they exist as two inherently different entities that change under different conditions?
Oh, you may also be interested in this related video discussion between Paul Ehrlich and Carl Zimmer — where Ehrlich advocates that cultural evolution needs its own theoretical framework aside from evolutionary biology. Strange proposition, especially because he used a natural selection framework in his latest PNAS paper.
- Pagel, M., Atkinson, Q.D., Meade, A. (2007). Frequency of word-use predicts rates of lexical evolution throughout Indo-European history. Nature, 449(7163), 717-720. DOI: 10.1038/nature06176
- Byrne, R.W. (2007). Culture in great apes: using intricate complexity in feeding skills to trace the evolutionary origin of human technical prowess. Philosophical Transactions of the Royal Society B: Biological Sciences, 362(1480), 577-585. DOI: 10.1098/rstb.2006.1996
- Whitfield, J. (2008). Across the Curious Parallel of Language and Species Evolution. PLoS Biology, 6(7), e186. DOI: 10.1371/journal.pbio.0060186
Differences Between Cognition & Memory Of Males And Females Linked To Two Genes
Peter Giese of the Institue of Psychiatry at King’s College London, University of London has been studying the differences between male and female memory. According to this Telegraph news piece, he’s identified two sex based genes in males but not females which function in cognitive and memory functions.
“The researchers used mice to study the role that certain genes play in how long term memories are made in males and females. Using a series of tests such as a maze they were able to show that male mice were faster at making the spatial memories that allowed them to learn a route out of the maze.
…Giese and his team then bred mice that lacked two key genes and found that the males were no longer able to learn the route out of a maze. The females, however, were unaffected by the loss of these genes.”
Unfortunately, Richard Gray, the man who wrote up this news piece failed to identify where and when this research was published, or originated from. I’ve noticed that this is a growing trend in science reporting, where the journalist dumbs down the piece so much that they leave out critical information like whether or not the results were published in a peer-review journal or just anounced by Giese. The Telegraph is especially guilty of this lapse in ethical standards. They consistently leave out citing the sources of information in their reports.
In all honesty, I’d really like to know whether or not Gray just interviewed Giese or also read and translated his paper. It is not explicity indicated in the Telegraph paper. From what I can tell, he only interviewed Giese. I could email Dr. Giese and ask him, myself, but that defeats the whole purpose of reporting science. Doesn’t news coverage of science function to give us an overview of the facts, as well as a primary source where we can investigate the facts for ourselves?
A 3D Computed Tomography Scan Of The Liujiang Cranium
A couple days ago, press release agencies like EurekAlert! and ScienceDaily ran some anthropology blips that was not picked up by major news sources. So if you don’t follow them you would have missed out on this news.
In a nutshell, Wu Xiujie, from the Institute of Vertebrate Paleontology and Paleoanthropology of the Chinese Academy of Sciences, has completed a 3D computed tomography scan of the Liujiang cranium. The Liujiang cranium was discovered in the Tongtianyan Cave
of the Guangxi Zhuang region in 1958 by some farmers. It looks remarkably modern, actually very similar to 20,000 year old skulls from Japan, but no quantifiable dating technique was ever preformed on the samples until many years later.
A group of Chinese researchers collaborated with Phillip Tobias in 2002 and dated the probable sediments via uranium-series dating. They figured the sediments dated to 111,000 to 139,000 years ago. But since the actual stratigraphic layer where the fossil came out of is unknown, they extended the age range to 68,000 years to 153,000 years old. The citation is provided below.
If Liujiang, a modern looking cranium, is truly 153,000 years old — then it directly competes with the modern looking crania from Bouri and Omo, Ethiopia, dating to similar time period and challenges the out of Africa model of human dispersal. Given the uncertainty of the exact stratigraphic layer the fossil came from, people have simply considered it the most complete human fossil from late Pleistocene China, (130,000 to 10,000 years ago).
Why they didn’t date the calcite embedded to the surface and interior of the skull is beyond me. All I know is that the Chinese have consistently and ungracefully tried to prove their version of a multiregional evolution of Homo sapiens, where the deme that originated in China is the oldest and had the most modern set of features before any other deme.
Along with the uncertainty of dates is the uncertainty of the exact phyletic relationship of Liujiang to other crania. Sure it looks modern looking on the outside, but what about the interior morphology? The scan has allowed researchers to virtually reconstruct a representation of the structure and shape of the brain and they conclude that the,
“morphological features of the Liujiang brain are in common with modern humans, including a round brain shape, bulged and wide frontal lobes, an enlarged brain height, a full orbital margin and long parietal lobes.
There are a few differences between Liujiang and the modern Chinese in our sample, including a strong posterior projection of the occipital lobes, and a reduced cerebellar lobe. The measurement of the virtual endocast shows that the endocranial capacity of Liujiang is 1567 cc, which is in the range of Late Homo sapiens and much beyond the mean of modern humans. The brain morphology of Liujiang is assigned to Late Homo sapiens.”
- Shen, G. (2002). U-Series dating of Liujiang hominid site in Guangxi, Southern China. Journal of Human Evolution, 43(6), 817-829. DOI: 10.1006/jhev.2002.0601
The 28,000 Year Old Paglicci 23 Cro-Magnon mtDNA Ain’t Neandertal — It Is More Modern Than Anything Else
The open access journal PLoS One has published a new ancient DNA paper, “A 28,000 Years Old Cro-Magnon mtDNA Sequence Differs from All Potentially Contaminating Modern Sequences.” One which establishes, yet again, that the Neandertal mitochondrial hypervariable region I is much different from modern humans. This was done by extracting mtDNA from the Paglicci 23 specimen, understood to be a Cro-Magnon individual.
Paglicci 23 was discovered by Francesco Mallegni, one of the authors of the current paper, in 2003 from the Paglicci Cave site.
I think the Paglicci Cave site is currently the earliest Aurignacian-Gravettian site in Italy — dating to be 34,000 years old. Anyone know for sure?
Either way, the Paglicci 23 and is represented by a tibia, skulls, jaw and maxilla. Radiocarbon dating indicates the remains are 28,100 years old. It was not excavated nor handled in sterile conditions. It was washed and analyzed by seven people since then, raising the possibility of contamination from modern human DNA.
In 2005, a piece of the tibia and two pieces of the skull were moved to a DNA lab at the University of Florence, where DNA was extracted, the hypervariable region I of the mtDNA amplified and sequenced. It should be noted that the bone was washed with bleach and irradiated with UV light and mtDNA was isolated from tissue inside the bone — not directly handled by people. The mtDNA of the people who handled the remains was also isolated and sequenced. This was done to see if their DNA contaminated the sample, since the remains weren’t handled under sterile conditions.
This procedure was repeated in another laboratory, by Carles Lalueza Fox in Barcelona, using a tibia fragment. Carles Lalueza Fox is a big name in ancient DNA studies, one of the guys who sequenced FOXP2 from Neandertal remains. Oh also, using Neandertal specific primers for the PCR, yielded no results — indicating that the remains were modern human… but more on that later.
Anne Holden blogger at 23andMe, who says she specializes in science writing, hails this paper in providing a “novel way,” of identifying contamination –
“by analyzing the DNA of everyone who touched a fossil for comparison in order to rule out contamination.”
She’s mistaken. What Caramelli et al. have done in this paper is hardly novel. I covered news of a May, 2008 paper in Science which isolated and extract mtDNA from 4,000 year old hair from Greenland. The hair was also not excavated under sterile conditions. In that paper, the DNA of everyone who handled the sample was also screen and compared to the sample in order to rule out contamination. And that’s just one example of preventative measures in sequencing ancient DNA that immediately comes to mind.
Anyways, the relationship between the Paglicci 23 sequence and all the sequences from the seven individuals who touched the specimen was investigated. In addition, the sequences were compared against other Cro-Magnon and Neandertal sequences. They had some problems which were resolved by treating the DNA extract was treated with Uracyl-N-Glycosidase (UNG). The authors conclude that,
“the Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans.”
In fact, they write,
“we concluded that the sequence obtained from the Paglicci 23 specimen is the CRS.”
The press is saying that the results are first ever demonstration ‘that the anatomical differences between Neandertals and Cro-Magnoids were associated with clear genetic differences.’ That’s overshooting the analysis. There are clear differences in the mitochondrial genome of Neandertals and Homo sapiens, and this is not the first paper to document it. And all this shows is that the Neandertals are not the ancestors of modern Europeans.
- Caramelli, D., Milani, L., Vai, S., Modi, A., Pecchioli, E., Girardi, M., Pilli, E., Lari, M., Lippi, B., Ronchitelli, A., Mallegni, F., Casoli, A., Bertorelle, G., Barbujani, G., Harpending, H. (2008). A 28,000 Years Old Cro-Magnon mtDNA Sequence Differs from All Potentially Contaminating Modern Sequences. PLoS ONE, 3(7), e2700. DOI: 10.1371/journal.pone.0002700
Charles Lockwood In Memoriam
From John Lynch, of Stranger Fruit, comes the upsetting news of Charles Lockwood‘s untimely death. He died in a motorcycle accident in London.
For those that don’t know who Charles Lockwood was, he was a paleoanthropologist who investigated the evolution of skull anatomy in hominins. Last year, his book “The Human Story: Where We Come From & How We Evolved,” came out. John Lynch has had the pleasure to do research with him, and has posted several citations where he and Locwood, along with Bill Kimbel published their geometric analysis of temporal bone variation in hominins. Do check them out.
Unfortunately, I never met Charles but have read almost a dozen of his papers. The last paper I remember reading of his was his July 2007 study with Claire Terhune and Bill Kimbel — where they concluded that their comparative sample of 520 extant and fossil hominid temporal bones indicated that H. erectus exhibited more intraspecific variation than other hominids. I was impressed with this paper and have always understood him to be an archetypal, high quality anatomist and field scientist — someone who inspired me. He will be missed.
Episode 1: A ScreenCast Tutorial On How-To Do A Multiple Sequence Alignment & Draw A Phylogenetic Tree Using Swami
The last time I did a little tutorial on how to use bioinformatic tools in anthropological research was last October. I’ve had some ideas since then and have decided to restart this project. The biggest change is the screencast format, rather than a set of static instructions.
Today, I’d like to introduce you to the first installation in this series of tutorials on how to use commonly used bioinformatic tools such as a multiple sequence alignment and drawing a phylogenetic tree. Multiple sequence alignments and phylogenetic trees are used in evolutionary analyses to understand the similarities and differences in sequences of DNA, RNA, or amino acids. The basic premise is built off the understanding that more similar sequences are more related than dissimilar sequences.
In this episode, I compare the D-Loop sequence of the mitochondrial genome of two Neandertals, one modern human, a chimpanzee, gorilla and orangutan using Swami — a cohesive collection of commonly used tools. Swami allows us to do a mutliple sequence alignment and generate a phylogenetic tree. The results are displayed above and to the right. I’ve recorded this 7 min 30 second screencast for you to follow. If you’d like to give it a run for yourself, here’s the array of primate D-Loop sequences I’ve used:
>Neandertal-1 (AF254446.1) CCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACATTACTGCCAGCCACCATGAATATTG TACAGTACCATAATTACTTGACTACCTGTAATACATAAAAACCTAATCCACATCAACCCCCCCCCCCCAT GCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACAACTCCAAAGACACCCTTAC ACCCACTAGGATATCAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACAT AGCACATTATAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGA >Neandertal-2 (AF011222.1) GTTCTTTCATGGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAGCAACCGCTATGTAT CTCGTACATTACTGTTAGTTACCATGAATATTGTACAGTACCATAATTACTTGACTACCTGCAGTACATA AAAACCTAATCCACATCAAACCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTC ATACATCAACTACAACTCCAAAGACGCCCTTACACCCACTAGGATATCAACAAACCTACCCACCCTTGAC AGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGA TGACCCCCCTCAGATAGGGGTCCCTTGAT >Human (X90314.1) TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATT TCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAA AAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCA CACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAG TACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATG ACCCCCCTCA >Chimpanzee (AF176766.1) GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGA ATATTGTACAGTACTATAACCACTCAACTACCTATAATACATTAAGCCCACCCCCACATTACAACCTCCA CCCTATGCTTACAAGCACGCACAACAATCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACAC CCCTCTCCCACCCCGATACCAACAAACCTATGCCCTTTTAACAGTACATAGTACATACAGCCGTACATCG CACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGATAGG >Gorilla (AF089820.1) TTCTTTCATGGGGAGACGAATTTGGGTGCCACCCAAGTATTAGTTAACCCACCAATAATTGTCATGTATG TCGTGCATTACTGCCAGCCACCATGAATAATGTACAGTACCACAAACACTCCCCCACCTATAATACATTA CCCCCCCTCACCCCCCATTCCCTGCTCACCCCAACGGCATACCAACCAACCTATCCCCTCACAAAAGTAC ATAATACATAAAATCATTTACCGTCCATAGTACATTCCAGTTAAACCATCCTCGCCCCCACGGATGCCCC CCTTCAGATAGGGATCCCTTAAA >Orangutan (X97708.1) TTCTTTCATGGGGGACCAGATTTGGGTGCCACCCCAGTACTGACCCATTTCTAACGGCCTATGTATTTCG TACATTCCTGCTAGCCAACATGAATATCACCCAACACAACAATCGCTTAACCAACTATAATGCATACAAA ACTCCAACCACACTCGACCTCCACACCCCGCTTACAAGCAAGTACCCCCCCATGCCCCCCCACCCAAACA CATACACCGATCTCTCCACATAACCCCTCAACCCCCAGCATATCAACAGACCAAACAAACCTTAAAGTAC ATAGCACATACTATCCTAACCGCACATAGCACATCCCGTTAAAACCCTGCTCATCCCCACGGATGCCCCC CCTCAGTTAGTAATCCCTTACT
Please check it out and let me know what you think of it, i.e. do you like this format? Did you find it useful? Was I moving too fast, did I explain what I was doing thoroughly? And lastly, what would you like to see?
Homo heidelbergensis Ear Anatomy Indicates They Could Have Heard The Same Frequency of Sounds As Modern Humans
Pinpointing when language became a prevalent trait during human evolution has been tricky. Last fall we read a paper which documented that Neandertals have the same FOXP2 sequence as modern humans. FOXP2 is a transcription factor associated with language. Two recent papers have shown that chimpanzees and humans have very similar structures in the brain that function in processing and producing sound. And despite the fact that several non-human apes have well known, documented histories of comprehending and communicating in sign language or with language boards, there has not been a consensus on when language definitively arose.
Rolf Quam, of the American Natural History Museum, along with several other colleagues have been investigating this issue. He’s been looking at the ear bones of Homo heidelbergensis, and he thinks they were capable of hearing sounds similar to how people do today. In other words, their ear bone anatomy is remarkably similar to modern Homo sapiens, despite the fact that Homo heidelbergensis is not directly related. The team reported their findings July 3 in Paris during the Acoustics ’08 conference.
From the press release,
“The skulls are from a site in Atapuerca, Spain called Sima de los Huesos, or “pit of the bones.” The Atapuerca research team, which includes members from many disciplines and universities, used CT scanning of the skulls to reconstruct the size and shape of the ear canals, Quam says.
The length of the ear canal determines what frequencies of sound waves resonate, and are therefore heard more easily, says Sunil Puria of Stanford University, who models hearing patterns from ear structure.The geometry of the ear canal reveals that the hearing patterns of H. heidelbergensis overlapped with those of modern-day humans. Both modern people and the ancient hominids have especially sharp hearing in the 2 kilohertz to 4 kilohertz frequency range, where much of the sound energy of spoken language is transmitted….
…The results don’t necessarily show that the ancient humans could speak, Quam says. “We’re saying that the ear changed for some reason and that those changes facilitated the possibility of language development,” he says.”

Like in modern humans (shown in solid blue), the ear canal of H. heidelbergensis (shown in red and magenta lines) had a peak in auditory sensitivity in the frequency range from 2 kilohertz to 4 kilohertz, where much spoken information is transmitted. Chimpanzees (shown in solid green) have a dip in sensitivity in that range.
All this really shows is that H. heidelbergensis could hear in the frequency range as modern humans. While I think it is very possible H. heidelbergensisis communicated, this research can not indicate that they used their ‘modern ear anatomy’ for anything special.

