<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	xmlns:georss="http://www.georss.org/georss" xmlns:geo="http://www.w3.org/2003/01/geo/wgs84_pos#" xmlns:media="http://search.yahoo.com/mrss/"
	>

<channel>
	<title>Anthropology.net &#187; Audio</title>
	<atom:link href="http://anthropology.net/category/content-type/audio/feed/" rel="self" type="application/rss+xml" />
	<link>http://anthropology.net</link>
	<description>Beyond bones &#38; stones</description>
	<lastBuildDate>Fri, 10 Feb 2012 10:54:37 +0000</lastBuildDate>
	<language>en</language>
	<sy:updatePeriod>hourly</sy:updatePeriod>
	<sy:updateFrequency>1</sy:updateFrequency>
	<generator>http://wordpress.com/</generator>
<cloud domain='anthropology.net' port='80' path='/?rsscloud=notify' registerProcedure='' protocol='http-post' />
<image>
		<url>http://0.gravatar.com/blavatar/aac6e480eb087b41a5008c996dd0a464?s=96&#038;d=http%3A%2F%2Fs2.wp.com%2Fi%2Fbuttonw-com.png</url>
		<title>Anthropology.net &#187; Audio</title>
		<link>http://anthropology.net</link>
	</image>
	<atom:link rel="search" type="application/opensearchdescription+xml" href="http://anthropology.net/osd.xml" title="Anthropology.net" />
	<atom:link rel='hub' href='http://anthropology.net/?pushpress=hub'/>
		<item>
		<title>&#8216;Desert Days&#8217; An Interview with Dr. Fred Wendorf &#8211; The Archaeology Channel</title>
		<link>http://anthropology.net/2009/07/15/desert-days-an-interview-with-dr-fred-wendorf-the-archaeology-channel/</link>
		<comments>http://anthropology.net/2009/07/15/desert-days-an-interview-with-dr-fred-wendorf-the-archaeology-channel/#comments</comments>
		<pubDate>Wed, 15 Jul 2009 20:02:12 +0000</pubDate>
		<dc:creator>Tim Jones</dc:creator>
				<category><![CDATA[Archaeology]]></category>
		<category><![CDATA[Audio]]></category>
		<category><![CDATA[Blog]]></category>

		<guid isPermaLink="false">http://anthropology.net/?p=2236</guid>
		<description><![CDATA[In something of a break from recent video tradition, The Archaeology Channel have produced an audio interview, Desert Days with Dr. Fred Wendorf,  Henderson-Morrison Professor of Prehistory Emeritus, Southern Methodist University (SMU), hosted by Rick Pettigrew, founder and President of Archaeological Legacy Institute. Here&#8217;s the show description: Dr. Fred Wendorf came of age and began [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=2236&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>In something of a break from recent video tradition, <a href="http://www.archaeologychannel.org/">The Archaeology Channel</a> have produced an audio interview, <em><a href="http://www.archaeologychannel.org/content/audio/wendorfint.html">Desert Days</a></em> with <a href="http://www.archaeologychannel.org/content/audio/wendorfint.html#AboutFredWendorf">Dr. Fred Wendorf</a>,  Henderson-Morrison Professor of Prehistory Emeritus, Southern Methodist University (SMU), hosted by Rick Pettigrew, founder and President of <img class="alignright size-full wp-image-2238" title="DrFredWendorf-sm-13.9.6" src="http://anthropologynet.files.wordpress.com/2009/07/drfredwendorf-sm-13-9-6.jpg?w=700" alt="DrFredWendorf-sm-13.9.6"   />Archaeological Legacy Institute. Here&#8217;s the show description:</p>
<blockquote><p><em>Dr. Fred Wendorf came of age and began his career during a formative period in American archaeology. But after leaving his permanent mark on the development of archaeology in the American Southwest and the United States, he essentially founded the study of the prehistoric eastern Sahara, beginning with the Aswan Dam Project in the Nile River Valley. His life, nearly ended by a bullet on a WWII battlefield in Italy, has included an archaeological research career spanning six decades and an unsurpassed record of seminal contributions. His recently published book, <a href="http://www.tamu.edu/upress/BOOKS/2008/wendorf.htm">Desert Days: My Life as a Field Archaeologist</a>, is a record not only of a life, but of an epoch in the history of archaeology on two continents. This is history he not just witnessed, but to a significant degree he created it through his innovative approaches and endless energy, which should serve as an inspiration to subsequent generations of archaeologists. </em></p>
<p><em>Dr. Richard Pettigrew of ALI interviewed Dr. Wendorf for The Archaeology Channel on two separate occasions, first in person at the Society for American Archaeology Conference in Atlanta on April 24, 2009, and then over the telephone on June 9, 2009. Guided by Dr. Wendorf&#8217;s book, this interview covers a wide array of topics, including his role in the creation of the first truly large contract archaeology projects in the United States, his momentous and very fruitful decision to launch a field expedition in the Nile River Valley against the wishes and advice of others, and the contributions of his research toward the understanding of human cultural development. Personal anecdotes combine with long considered assessments to paint a genuine picture of his life and career and the era they have spanned.</em></p></blockquote>
<p>As will be apparent from this link, it was Dr. Wendorf and his colleague <a href="http://archaeology.about.com/b/2007/05/14/venus-figurine-variations-the-photos.htm">Romuald Schild</a> who were the first to discover <a href="http://archaeology.about.com/od/nterms/g/nabta_playa.htm">Nabta Playa</a>, back in 1994, a site  familiar to many, especially because of the Neolithic stone circle, a great surprise given its geographical location in the southern reaches of modern-day Egypt. The site is interesting because it is said to span from 8,500 BP when it&#8217;s thought the inhabitants were pastoralists tending sheep and goats, whose Middle Neolithic descendants went on to practice agriculture and the building of megalithic structures. Indeed it was sites such as this that reinforced the idea that ritual activities became more complex over thousands of years as agricultural people began to settle into sedentary lives, and found themselves with ample time to engage in erecting monumental structures related to their spiritual beliefs &#8211; until the discovery at Göbekli Tepe, where it emerged that stone monuments and circles erected around 12,000 years ago, actually preceded full-scale or or widespread agriculture.</p>
<p>There aren&#8217;t many archaeologists around today who can claim 60 years service in the field, much of which has been spent in the desert regions of the Sahara, and yet who can still find the time to write 30 books and numerous journal articles &#8211; I&#8217;m still listening as I write this, so on this occasion I&#8217;ll refrain from commenting further for now, other than to recommend setting aside an hour or so to sit back and listen to Dr. Wendorf&#8217;s interview in its entirety, as he recounts some of the many fascinating anecdotes of his field experiences.</p>
<br />Posted in Archaeology, Audio, Blog  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/anthropologynet.wordpress.com/2236/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/anthropologynet.wordpress.com/2236/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/anthropologynet.wordpress.com/2236/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/anthropologynet.wordpress.com/2236/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/anthropologynet.wordpress.com/2236/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/anthropologynet.wordpress.com/2236/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/anthropologynet.wordpress.com/2236/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/anthropologynet.wordpress.com/2236/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/anthropologynet.wordpress.com/2236/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/anthropologynet.wordpress.com/2236/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/anthropologynet.wordpress.com/2236/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/anthropologynet.wordpress.com/2236/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/anthropologynet.wordpress.com/2236/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/anthropologynet.wordpress.com/2236/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=2236&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://anthropology.net/2009/07/15/desert-days-an-interview-with-dr-fred-wendorf-the-archaeology-channel/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/882cd21fa184fe89cfbf1a8b6d21ff79?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=G" medium="image">
			<media:title type="html">Tim Jones</media:title>
		</media:content>

		<media:content url="http://anthropologynet.files.wordpress.com/2009/07/drfredwendorf-sm-13-9-6.jpg" medium="image">
			<media:title type="html">DrFredWendorf-sm-13.9.6</media:title>
		</media:content>
	</item>
		<item>
		<title>Episode 1: A ScreenCast Tutorial On How-To Do A Multiple Sequence Alignment &amp; Draw A Phylogenetic Tree Using Swami</title>
		<link>http://anthropology.net/2008/07/13/episode-1-a-screencast-tutorial-on-how-to-do-a-multiple-sequence-alignment-draw-a-phylogenetic-tree-using-swami/</link>
		<comments>http://anthropology.net/2008/07/13/episode-1-a-screencast-tutorial-on-how-to-do-a-multiple-sequence-alignment-draw-a-phylogenetic-tree-using-swami/#comments</comments>
		<pubDate>Mon, 14 Jul 2008 07:34:01 +0000</pubDate>
		<dc:creator>Kambiz Kamrani</dc:creator>
				<category><![CDATA[Blog]]></category>
		<category><![CDATA[Physical Anthropology]]></category>
		<category><![CDATA[Podcast]]></category>
		<category><![CDATA[Video]]></category>
		<category><![CDATA[bioinformatics]]></category>
		<category><![CDATA[human evolution]]></category>
		<category><![CDATA[multiple sequence alignments]]></category>
		<category><![CDATA[phylogenetics]]></category>

		<guid isPermaLink="false">http://anthropologynet.wordpress.com/?p=996</guid>
		<description><![CDATA[The last time I did a little tutorial on how to use bioinformatic tools in anthropological research was last October. I&#8217;ve had some ideas since then and have decided to restart this project. The biggest change is the screencast format, rather than a set of static instructions. Today, I&#8217;d like to introduce you to the [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=996&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>The last time I did a little tutorial on how to use bioinformatic tools in anthropological research <a href="http://anthropology.net/2007/10/01/how-to-use-common-bioinformatic-tools-to-compare-two-neandertal-sequeences/">was last October</a>. I&#8217;ve had some ideas since then and have decided to restart this project. The biggest change is the screencast format, rather than a set of static instructions.<a rel="attachment wp-att-1001" href="http://anthropology.net/2008/07/13/episode-1-a-screencast-tutorial-on-how-to-do-a-multiple-sequence-alignment-draw-a-phylogenetic-tree-using-swami/an-unrooted-tree-neandertal-human-chimp-gorilla-orangutan-dloop-mtdna/"><img class="alignright size-medium wp-image-1001" src="http://anthropologynet.files.wordpress.com/2008/07/an-unrooted-tree-neandertal-human-chimp-gorilla-orangutan-dloop-mtdna.jpg?w=300&#038;h=237" alt="" width="300" height="237" /></a></p>
<p>Today, I&#8217;d like to introduce you to the first installation in this series of tutorials on how to use commonly used bioinformatic tools such as a multiple sequence alignment and drawing a phylogenetic tree. Multiple sequence alignments and phylogenetic trees are used in evolutionary analyses to understand the similarities and differences in sequences of DNA, RNA, or amino acids. The basic premise is built off the understanding that more similar sequences are more related than dissimilar sequences.</p>
<p>In <a href="http://blip.tv/file/1075550">this episode</a>, I compare the D-Loop sequence of the mitochondrial genome of two Neandertals, one modern human, a chimpanzee, gorilla and orangutan using <a href="http://www.ngbw.org/">Swami</a> &#8212; a cohesive collection of commonly used tools. Swami allows us to do a mutliple sequence alignment and generate a phylogenetic tree. The results are displayed above and to the right. I&#8217;ve recorded this 7 min 30 second screencast for you to follow. If you&#8217;d like to give it a run for yourself, here&#8217;s the array of primate D-Loop sequences I&#8217;ve used:</p>
<p><pre class="brush: css;">
&gt;Neandertal-1 (AF254446.1)
CCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACATTACTGCCAGCCACCATGAATATTG
TACAGTACCATAATTACTTGACTACCTGTAATACATAAAAACCTAATCCACATCAACCCCCCCCCCCCAT
GCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACAACTCCAAAGACACCCTTAC
ACCCACTAGGATATCAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACAT
AGCACATTATAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGA

&gt;Neandertal-2 (AF011222.1)
GTTCTTTCATGGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAGCAACCGCTATGTAT
CTCGTACATTACTGTTAGTTACCATGAATATTGTACAGTACCATAATTACTTGACTACCTGCAGTACATA
AAAACCTAATCCACATCAAACCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTC
ATACATCAACTACAACTCCAAAGACGCCCTTACACCCACTAGGATATCAACAAACCTACCCACCCTTGAC
AGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGA
TGACCCCCCTCAGATAGGGGTCCCTTGAT

&gt;Human (X90314.1)
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATT
TCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAA
AAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCA
CACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAG
TACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATG
ACCCCCCTCA

&gt;Chimpanzee (AF176766.1)
GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGA
ATATTGTACAGTACTATAACCACTCAACTACCTATAATACATTAAGCCCACCCCCACATTACAACCTCCA
CCCTATGCTTACAAGCACGCACAACAATCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACAC
CCCTCTCCCACCCCGATACCAACAAACCTATGCCCTTTTAACAGTACATAGTACATACAGCCGTACATCG
CACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGATAGG

&gt;Gorilla (AF089820.1)
TTCTTTCATGGGGAGACGAATTTGGGTGCCACCCAAGTATTAGTTAACCCACCAATAATTGTCATGTATG
TCGTGCATTACTGCCAGCCACCATGAATAATGTACAGTACCACAAACACTCCCCCACCTATAATACATTA
CCCCCCCTCACCCCCCATTCCCTGCTCACCCCAACGGCATACCAACCAACCTATCCCCTCACAAAAGTAC
ATAATACATAAAATCATTTACCGTCCATAGTACATTCCAGTTAAACCATCCTCGCCCCCACGGATGCCCC
CCTTCAGATAGGGATCCCTTAAA

&gt;Orangutan (X97708.1)
TTCTTTCATGGGGGACCAGATTTGGGTGCCACCCCAGTACTGACCCATTTCTAACGGCCTATGTATTTCG
TACATTCCTGCTAGCCAACATGAATATCACCCAACACAACAATCGCTTAACCAACTATAATGCATACAAA
ACTCCAACCACACTCGACCTCCACACCCCGCTTACAAGCAAGTACCCCCCCATGCCCCCCCACCCAAACA
CATACACCGATCTCTCCACATAACCCCTCAACCCCCAGCATATCAACAGACCAAACAAACCTTAAAGTAC
ATAGCACATACTATCCTAACCGCACATAGCACATCCCGTTAAAACCCTGCTCATCCCCACGGATGCCCCC
CCTCAGTTAGTAATCCCTTACT
</pre></p>
<p>Please check it out and let me know what you think of it, i.e. do you like this format? Did you find it useful? Was I moving too fast, did I explain what I was doing thoroughly? And lastly, what would you like to see?</p>
<p style="text-align:center;"><script type="text/javascript" src="http://blip.tv/syndication/write_player?skin=js&posts_id=1081730&cross_post_destination=-1&view=full_js"></script></p>
<br /><img alt="" border="0" src="http://feeds.wordpress.com/1.0/categories/anthropologynet.wordpress.com/996/" /> <img alt="" border="0" src="http://feeds.wordpress.com/1.0/tags/anthropologynet.wordpress.com/996/" /> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/anthropologynet.wordpress.com/996/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/anthropologynet.wordpress.com/996/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/anthropologynet.wordpress.com/996/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/anthropologynet.wordpress.com/996/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/anthropologynet.wordpress.com/996/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/anthropologynet.wordpress.com/996/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/anthropologynet.wordpress.com/996/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/anthropologynet.wordpress.com/996/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/anthropologynet.wordpress.com/996/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/anthropologynet.wordpress.com/996/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/anthropologynet.wordpress.com/996/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/anthropologynet.wordpress.com/996/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/anthropologynet.wordpress.com/996/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/anthropologynet.wordpress.com/996/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=996&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://anthropology.net/2008/07/13/episode-1-a-screencast-tutorial-on-how-to-do-a-multiple-sequence-alignment-draw-a-phylogenetic-tree-using-swami/feed/</wfw:commentRss>
		<slash:comments>5</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/fa44ed814a8998518e9bef18d02b1d46?s=96&#38;d=http%3A%2F%2F1.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=G" medium="image">
			<media:title type="html">kambiz</media:title>
		</media:content>

		<media:content url="http://anthropologynet.files.wordpress.com/2008/07/an-unrooted-tree-neandertal-human-chimp-gorilla-orangutan-dloop-mtdna.jpg?w=300" medium="image" />
	</item>
		<item>
		<title>Michael Tomasello on How Humans Are Unique</title>
		<link>http://anthropology.net/2008/05/29/michael-tomasello-on-how-humans-are-unique/</link>
		<comments>http://anthropology.net/2008/05/29/michael-tomasello-on-how-humans-are-unique/#comments</comments>
		<pubDate>Thu, 29 May 2008 20:48:48 +0000</pubDate>
		<dc:creator>Kambiz Kamrani</dc:creator>
				<category><![CDATA[Audio]]></category>
		<category><![CDATA[Blog]]></category>
		<category><![CDATA[Cultural Anthropology]]></category>
		<category><![CDATA[Physical Anthropology]]></category>
		<category><![CDATA[Podcast]]></category>
		<category><![CDATA[cognition]]></category>
		<category><![CDATA[comparative psychology]]></category>
		<category><![CDATA[culture]]></category>
		<category><![CDATA[evolutionary psychology]]></category>
		<category><![CDATA[michael tomasello]]></category>
		<category><![CDATA[primatology]]></category>
		<category><![CDATA[Psychology]]></category>

		<guid isPermaLink="false">http://anthropologynet.wordpress.com/?p=871</guid>
		<description><![CDATA[Michael Tomasello, a well known comparative psychologist, has a column in today&#8217;s New York Times where he writes on, &#8220;How Are Humans Unique?&#8221; In the piece, Tomasello argues that our cultural, linguistic, economic and tool-use have all come about because of our tendency for &#8220;collective cognition.&#8221; His argument stems from two of his recent papers, [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=871&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p><a href="http://email.eva.mpg.de/~tomas/">Michael Tomasello</a>, a well known comparative psychologist, has a column in today&#8217;s <em>New York Times</em> where he writes on, &#8220;<a href="http://www.nytimes.com/2008/05/25/magazine/25wwln-essay-t.html">How Are Humans Unique?</a>&#8221; In the piece, Tomasello argues that our cultural, linguistic, economic and tool-use have all come about because of our tendency for &#8220;collective cognition.&#8221;</p>
<p>His argument stems from two of his recent papers, the first, &#8220;<a href="http://www.sciencemag.org/cgi/content/citation/319/5863/569c">Comparing Social Skills of Children and Apes</a>,&#8217; was authored along with <a href="http://www.emory.edu/LIVING_LINKS/dewaal.html">Frans B. M. De Waal,</a> <a href="http://www.eva.mpg.de/primat/staff/boesch/index.html">Christophe Boesch</a>, <a href="http://www.emory.edu/LIVING_LINKS/horner.html">Victoria Horner</a>, <a href="http://www.st-andrews.ac.uk/~www_sp/people/lect/aw2.shtml">Andrew Whiten</a>, Esther Herrmann, <a href="http://www.eva.mpg.de/psycho/staff/call/index.htm">Josep Call</a>, María Victoria Hernández-Lloreda, <a href="http://email.eva.mpg.de/~hare/">Brian Hare</a>. Many of the same authors also joined Tomasello on the other paper, &#8220;<a href="http://www.sciencemag.org/cgi/content/full/317/5843/1360">Humans Have Evolved Specialized Skills of Social Cognition: The Cultural Intelligence Hypothesis</a>,&#8221; which I covered on <a href="http://primatology.net/2007/09/07/human-non-human-ape-social-cognition-compared-humans-have-evolved-specialized-skills/">Primatology.net in September 2007</a>.</p>
<p>The latter paper compared the congitive and problem solving skills of two &amp; half-year-old human children to those of chimps and orangutans ranging from 3 to 21 years old. The results showed that both are comparable in numerical and spatial skills. When comparing social skills, the human kids excelled over the chimps. An example, the toddlers learned how to open a container by imitating what they saw, where as the chimps did not mimic&#8230; Thus, the kids made connections like, &#8220;stick helps open box.&#8221; The chimps relied on trick of trial and error. The authors summarized that imitation is a fast way acquire a lot of knowledge and may have paved the way for our departure from these primate cousins – and ultimately allowed us to develop the complex social culture we have today.</p>
<p>The more recent paper, also involved comparing the social and cognitive abilities of children and chimps. Tomasello and his team concluded that humans recognize and commit to group tasks. Chimps, on the other hand, do not have such expectation of others. If and when the chimps did communicate, they did it to get others to do what they want. I&#8217;ll confirm that from my own experience with working with apes, gorillas, that they communicated to me almost exclusively to get what they want. In their experiment, communication amongst children was to share information.</p>
<p>Tomasello argues that only humans pretend. According to him humans imagine, and this ability has allowed us to build institutions. These adaptations, Tomasello writes, set us apart from apes, thereby allowing us to build modern civilization.</p>
<p>I believe I have seen and experienced non-human imagination in gorillas and also chimps. I, by no means have the accolades that Tomasello has, nor the experiences he has in analyzing psychological research but I think it is really hard to definitively say that <em>only</em> humans can imagine and pretend. To do that we&#8217;d really have to get ino their minds. I just don&#8217;t understand how we can know if non-human primates do or do not imagine.</p>
<p>If you&#8217;re interested in this topic, we have in the past, had some short discussions on what traits have made humans unique, such as <a href="http://anthropology.net/2008/02/19/marc-hausers-presents-four-traits-that-make-human-cognition-unique/">this one summarizing Marc Hauser&#8217;s postulates</a>. I also think you&#8217;ll enjoy this 60 second audio summarizing the discussion, made by <a href="http://www.sciam.com/podcast/episode.cfm?id=2BA90A6B-C679-1D75-05835D9B22FE24FC"> Christie Nicholson</a>, of Scientific American &#8212; which she draws a tangent to social networking sites, <a href="http://anthropology.net/2007/09/11/what-can-evolutionary-psychology-say-about-the-social-networking-fad/">something I commented about last September</a>.</p>
<p style="text-align:center;"><span style='text-align:left;display:block;'><p><object type='application/x-shockwave-flash' data='http://s0.wp.com/wp-content/plugins/audio-player/player.swf' width='290' height='24' id='audioplayer1'><param name='movie' value='http://s0.wp.com/wp-content/plugins/audio-player/player.swf' /><param name='FlashVars' value='&amp;bg=0xf8f8f8&amp;leftbg=0xeeeeee&amp;lefticon=0x666666&amp;rightbg=0xcccccc&amp;rightbghover=0x999999&amp;righticon=0x666666&amp;righticonhover=0xffffff&amp;text=0x666666&amp;slider=0x666666&amp;track=0xFFFFFF&amp;border=0x666666&amp;loader=0x9FFFB8&amp;soundFile=http%3A%2F%2Fkamrani.net%2Fkambiz%2Ffiles%2Fscientific-american-60-sec-psych-2008-05-29.mp3' /><param name='quality' value='high' /><param name='menu' value='false' /><param name='bgcolor' value='#FFFFFF' /><param name='wmode' value='opaque' /></object></p></span></p>
<br /><img alt="" border="0" src="http://feeds.wordpress.com/1.0/categories/anthropologynet.wordpress.com/871/" /> <img alt="" border="0" src="http://feeds.wordpress.com/1.0/tags/anthropologynet.wordpress.com/871/" /> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/anthropologynet.wordpress.com/871/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/anthropologynet.wordpress.com/871/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/anthropologynet.wordpress.com/871/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/anthropologynet.wordpress.com/871/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/anthropologynet.wordpress.com/871/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/anthropologynet.wordpress.com/871/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/anthropologynet.wordpress.com/871/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/anthropologynet.wordpress.com/871/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/anthropologynet.wordpress.com/871/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/anthropologynet.wordpress.com/871/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/anthropologynet.wordpress.com/871/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/anthropologynet.wordpress.com/871/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/anthropologynet.wordpress.com/871/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/anthropologynet.wordpress.com/871/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=871&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://anthropology.net/2008/05/29/michael-tomasello-on-how-humans-are-unique/feed/</wfw:commentRss>
		<slash:comments>5</slash:comments>
<enclosure url="http://kamrani.net/kambiz/files/scientific-american-60-sec-psych-2008-05-29.mp3" length="1467771" type="audio/x-mpeg" />
	
		<media:content url="http://1.gravatar.com/avatar/fa44ed814a8998518e9bef18d02b1d46?s=96&#38;d=http%3A%2F%2F1.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=G" medium="image">
			<media:title type="html">kambiz</media:title>
		</media:content>
	</item>
		<item>
		<title>A Podcast Interview on Ancient DNA from the Neanderthal Genome</title>
		<link>http://anthropology.net/2007/07/22/a-podcast-interview-of-ancient-dna-from-the-neanderthal-genome/</link>
		<comments>http://anthropology.net/2007/07/22/a-podcast-interview-of-ancient-dna-from-the-neanderthal-genome/#comments</comments>
		<pubDate>Sun, 22 Jul 2007 18:27:53 +0000</pubDate>
		<dc:creator>Kambiz Kamrani</dc:creator>
				<category><![CDATA[Blog]]></category>
		<category><![CDATA[Physical Anthropology]]></category>
		<category><![CDATA[Podcast]]></category>

		<guid isPermaLink="false">http://anthropology.net/2007/07/22/a-podcast-interview-of-ancient-dna-from-the-neanderthal-genome/</guid>
		<description><![CDATA[I have a podcast I found thru Dr. Hsien-Hsien Lei&#8216;s blog, which actually came originally from Marc Pelletier of Futures in Biotech, that I wanna share withya. The podcast is fairly long, its about 45 minutes long. Marc interviewed Dr. Svante Pääbo, Director of the Department of Genetics at the Max Planck Institute for Evolutionary [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=280&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p align="left">I have a podcast I found thru <a href="http://www.eyeondna.com/about">Dr. Hsien-Hsien Lei</a>&#8216;s <a href="http://www.eyeondna.com/2007/07/14/dna-podcast-ancient-dna-from-the-neanderthal-genome/trackback/">blog</a>, which actually came originally from Marc Pelletier of <a href="http://www.twit.tv/fib11">Futures in Biotech</a>, that I wanna share withya. The podcast is fairly long, its about 45 minutes long.</p>
<p align="left">Marc interviewed Dr. <a href="http://email.eva.mpg.de/~paabo/">Svante Pääbo</a>, Director of the Department of Genetics at the Max Planck Institute for Evolutionary Anthropology, and Dr. Thomas Jarvie, Technical Application Manager at 454 Life Sciences, on ancient DNA and the Neandertal Genome Project. Marc discusses with Drs. Pääbo and Jarvie the limitations and benefits of sequencing ancient DNA, such as its heavy fragmentation, and how 454&#8242;s sequencing technology is more logical than enzymatic amplification and other methods, such as bacterial cloning.</p>
<p align="left">If this is a topic that interests you, you maybe interested to hear directly from the scientists in charge about what&#8217;s going on with their research.</p>
<p align="center">[odeo=http://odeo.com/audio/14453223/view]</p>
<p align="left"><strong>UPDATE</strong>: I just came across an Ars Technica discussion on <a href="http://arstechnica.com/journals/science.ars/2007/07/15/evolving-tools-for-ancient-dna">evolving tools for ancient DNA</a>, which also discusses the caveats to working with fragments of genomes.</p>
<br /><img alt="" border="0" src="http://feeds.wordpress.com/1.0/categories/anthropologynet.wordpress.com/280/" /> <img alt="" border="0" src="http://feeds.wordpress.com/1.0/tags/anthropologynet.wordpress.com/280/" /> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/anthropologynet.wordpress.com/280/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/anthropologynet.wordpress.com/280/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/anthropologynet.wordpress.com/280/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/anthropologynet.wordpress.com/280/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/anthropologynet.wordpress.com/280/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/anthropologynet.wordpress.com/280/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/anthropologynet.wordpress.com/280/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/anthropologynet.wordpress.com/280/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/anthropologynet.wordpress.com/280/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/anthropologynet.wordpress.com/280/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/anthropologynet.wordpress.com/280/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/anthropologynet.wordpress.com/280/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/anthropologynet.wordpress.com/280/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/anthropologynet.wordpress.com/280/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=280&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://anthropology.net/2007/07/22/a-podcast-interview-of-ancient-dna-from-the-neanderthal-genome/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/fa44ed814a8998518e9bef18d02b1d46?s=96&#38;d=http%3A%2F%2F1.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=G" medium="image">
			<media:title type="html">kambiz</media:title>
		</media:content>
	</item>
		<item>
		<title>Podcast Round-up</title>
		<link>http://anthropology.net/2007/06/30/podcast-round-up/</link>
		<comments>http://anthropology.net/2007/06/30/podcast-round-up/#comments</comments>
		<pubDate>Sat, 30 Jun 2007 20:14:22 +0000</pubDate>
		<dc:creator>Tim Jones</dc:creator>
				<category><![CDATA[Audio]]></category>
		<category><![CDATA[Blog]]></category>
		<category><![CDATA[Podcast]]></category>

		<guid isPermaLink="false">http://anthropology.net/2007/06/30/podcast-round-up/</guid>
		<description><![CDATA[Podcasting has arrived in a big way, as a cursory glance at the iTunes directory will confirm &#8211; if you can think of a science related topic, the chances are that someone somewhere will probably be talking about it. On that note, here&#8217;s a quick look at some which may be of interest to readers [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=210&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>Podcasting has arrived in a big way, as a cursory glance at the iTunes directory will confirm &#8211; if you can think of a science related topic, the chances are that someone somewhere will probably be talking about it. On that note, here&#8217;s a quick look at some which may be of interest to readers here &#8211; some are those I listen to, others were recommended to me by Carl at <a href="http://hotcupofjoe.blogspot.com/">Hot Cup of Joe</a>,<img src="http://www.de357.com/collections/morrison/images/radio.jpg" align="right" height="233" hspace="5" vspace="5" width="269" /> (and who also contributes to Anthropology.net), so many thanks to him for his suggestions. All shows listed below are available for free via iTunes, but if you don&#8217;t use that application, I&#8217;ve provided a link to each of the sites, from where you can either listen or download direct.</p>
<p><a href="http://www.abc.net.au/rn/allinthemind/default.htm">All In The Mind</a> &#8211; ABC</p>
<p>This show from Australia looks at issues involving psychology, with their two most recent shows looking at &#8216;mental surveillance&#8217;, discussing the unregulated domain of brain scanning in courts, our understanding of criminality, our susceptibility to becoming smokers or alcoholics based on our brain patterns, and a whole lot more &#8211; very well presented, and plenty to ponder over exactly how much free will we actually have.</p>
<p><a href="http://recap.ltd.uk/podcasting/humanities/archaeologica.php">Archaeology Channel</a></p>
<p>Here we have the weekly news from <a href="http://www.archaeologica.org/">Archaeologica</a>, who also run an excellent daily news service from their site.</p>
<p>n.b. The <a href="http://www.archaeologychannel.org/">Archaeology Channel </a>have an excellent range of video material on their site, the latest edition of which features an interview with Dr. Louise Leakey, yet another member of that famous family, discussing her work at Lake Turkana &#8211; also, be sure to check through their extensive archives for some very good presentations.</p>
<p><a href="http://clioaudio.com/"></a></p>
<p><a href="http://clioaudio.com/">Clioaudio</a>This is produced by Alun Salt, formerly of <a href="http://archaeoastronomy.co.uk/">Archaeoastronomy</a>, and although still in its early days, has already covered some very interesting topics, including the debate between archaeologists and pagans, regarding how we should treat the ancient remains of individuals who are discovered during the course of digs or other excavations.</p>
<p><a href="http://www.dogmafreeamerica.com/">Dogma Free America</a></p>
<p>One of Carl Feagan&#8217;s recommendations, a show which evidently looks at the ongoing debate between science and religion &#8211; at the time of writing I haven&#8217;t had time to listen, but looking through their past show summaries, it looks as though there is a wealth of good material to catch up on.</p>
<p><a href="http://news.bbc.co.uk/1/hi/programmes/from_our_own_correspondent/default.stm">From Our Own Correspondent</a></p>
<p>One of many from the BBC, this comes out quite often, sometimes twice in the same week. Each show features 3 separate reporters submitting a 10-minute piece from around the world, taking a look at people and places who wouldn&#8217;t necessarily make it into the headline news, but who nevertheless provide us with fascinating insights into any number of topics.<span id="more-210"></span></p>
<p><a href="http://www.bbc.co.uk/radio4/history/inourtime/">In Our Time</a></p>
<p>Another from the BBC, this one featuring presenter Melvyn Bragg and a handful of specialist guests brought in for each edition, who address a specific topic each week &#8211; the current edition looks at the Permian/Triassic extinction event, which wiped out over 95% of all life, some 250 million years ago.</p>
<p><a href="http://www.newscientist.com/podcast.ns">New Scientist</a></p>
<p>Also known as Scipod, this is a joint UK/US effort, and each week the two presenters take a look at topics typically covered in their magazine &#8211; this week it&#8217;s Richard Wiseman on something called &#8216;quirkology&#8217;.</p>
<p><a href="http://recap.ltd.uk/podcasting/citizenship/pointofenquiry.php">Point Of Enquiry</a></p>
<p>I only came across this recently, and this is a pretty good one &#8211; here&#8217;s my write up from remote central &#8211; &#8220;Each issue features a different guest, many of whom will be instantly recognisable &#8211; Phil Plait, Steven Pinker, Susan Blackmore, Richard Wiseman, Dennett and Dawkins, with even Salman Rushdie popping in for a visit. At the moment I&#8217;m listening to Prof. Eugenie Scott, of the Dover, Pa. 2005 trial fame, discussing Creationism masquerading as Intelligent Design, and the attempts by some to have both subjects taught together in the science classroom.&#8221;</p>
<p><a href="http://www.royalsoc.ac.uk/page.asp?id=3966">Royal Society</a></p>
<p>A mix of video and podcasting, not sure of this is still up and running as there have been no new editions since early May, but their past shows are still available.</p>
<p><a href="http://rusiriusradio.com/">RU Sirius Show</a></p>
<p>I actually first heard of this when Martin at <a href="http://scienceblogs.com/aardvarchaeology/">Aardvarchaeology</a> recommended it on his site. This is a long established show, and although not strictly tied to anthropology, nevertheless features plenty of material that will be of interest to many &#8211; current edition looks at &#8216;<em>Cyborgs, revolution and Steve Wozniak</em>&#8216;.</p>
<p><a href="http://www.sciam.com/podcast/">Science Talk</a></p>
<p>This is from Scientific American, and is a weekly look at science and technology in the news, as well as a host of other related topics discussed with different guests, always something of interest  &#8211;  SciAm have also started posting related <a href="http://www.sciam.com/videonews_directory.cfm">video news</a> content on their site, including a companion piece to their recent feature &#8216;<a href="http://www.sciam.com/article.cfm?articleID=49B0CB1C-E7F2-99DF-31B25137E601E0C5">Earth Without Humans</a>&#8216;, which looks at how New York would become transformed over the years, were we humans to suddenly vanish from the scene.</p>
<p><a href="http://www.skeptiko.com/">Skeptico</a></p>
<p>This is another podcast which dealing with issues of faith, belief, and topics such as scientific evidence, or lack thereof, for the afterlife  &#8211; again, one I haven&#8217;t had the chance to check thoroughly, but one that promises to have some good discussion &#8211; the latest edition focusses on what is described as the battle between religious and scientific fundamentalism, and looks at ways in which some type of compromise can be reached between the two sides to take the arguments forward, rather than becoming enmired in  the morass of verbal mudslinging which seems on occasion to dominate any debate.</p>
<p><a href="http://www.theskepticsguide.org/">Skeptics Guide To The Universe</a></p>
<p>Another recommendation by Carl, haven&#8217;t had a chance to properly listen yet, but the snoppets I&#8217;ve heard bode well for future listening &#8211; their latest issue discusses &#8216;<font><em>News Items:  Do black holes exist, President bush veto’s new stem cell bill, Legends for profit;</em>&#8216;</font></p>
<p><a href="http://www.twis.org/audio/2007/06/26/137/">This Week In Science</a></p>
<p>The final show to be featured here, which describes itself as &#8216;the kickass science podcast&#8217; and again, one recommended by Carl &#8211; this is another show I&#8217;ll have a listen to more fully later,  and they certainly appear to tackle a formidable range of topics, with interviews, so it should have something of interest  for all. There&#8217;s also a link from their main page to Seed Magazine&#8217;s &#8216;<a href="http://seedmagazine.com/writingcontest/">Science Writing Contest</a>&#8216;,  which I imagine would  attract the interest, and again, what little I&#8217;ve heard, is very well presented.</p>
<p>So that&#8217;s it for now &#8211; doubtless there are other podcasts out there of which I&#8217;m unaware, but hopefully those mentioned above will prove useful and hopefully entertaining to readers here &#8211; it&#8217;s just a question of finding the time to listen to them all , but one of the best thing about podcasting is that we&#8217;re no longer tied to radio schedules, which in the past, all too often meant that a show missed one week, was effectively a show missed for ever. Happy listening.  (TJ)</p>
<p>image from <a href="http://www.de357.com/collections/morrison/audionews.htm">here</a></p>
<br /><img alt="" border="0" src="http://feeds.wordpress.com/1.0/categories/anthropologynet.wordpress.com/210/" /> <img alt="" border="0" src="http://feeds.wordpress.com/1.0/tags/anthropologynet.wordpress.com/210/" /> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/anthropologynet.wordpress.com/210/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/anthropologynet.wordpress.com/210/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/anthropologynet.wordpress.com/210/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/anthropologynet.wordpress.com/210/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/anthropologynet.wordpress.com/210/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/anthropologynet.wordpress.com/210/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/anthropologynet.wordpress.com/210/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/anthropologynet.wordpress.com/210/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/anthropologynet.wordpress.com/210/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/anthropologynet.wordpress.com/210/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/anthropologynet.wordpress.com/210/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/anthropologynet.wordpress.com/210/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/anthropologynet.wordpress.com/210/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/anthropologynet.wordpress.com/210/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=anthropology.net&amp;blog=1146432&amp;post=210&amp;subd=anthropologynet&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://anthropology.net/2007/06/30/podcast-round-up/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/882cd21fa184fe89cfbf1a8b6d21ff79?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=G" medium="image">
			<media:title type="html">Tim Jones</media:title>
		</media:content>

		<media:content url="http://www.de357.com/collections/morrison/images/radio.jpg" medium="image" />
	</item>
	</channel>
</rss>
