Anthropology.net

The last time I did a little tutorial on how to use bioinformatic tools in anthropological research was last October. I’ve had some ideas since then and have decided to restart this project. The biggest change is the screencast format, rather than a set of static instructions.

Today, I’d like to introduce you to the first installation in this series of tutorials on how to use commonly used bioinformatic tools such as a multiple sequence alignment and drawing a phylogenetic tree. Multiple sequence alignments and phylogenetic trees are used in evolutionary analyses to understand the similarities and differences in sequences of DNA, RNA, or amino acids. The basic premise is built off the understanding that more similar sequences are more related than dissimilar sequences.

In this episode, I compare the D-Loop sequence of the mitochondrial genome of two Neandertals, one modern human, a chimpanzee, gorilla and orangutan using Swami — a cohesive collection of commonly used tools. Swami allows us to do a mutliple sequence alignment and generate a phylogenetic tree. The results are displayed above and to the right. I’ve recorded this 7 min 30 second screencast for you to follow. If you’d like to give it a run for yourself, here’s the array of primate D-Loop sequences I’ve used:

>Neandertal-1 (AF254446.1)
CCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACATTACTGCCAGCCACCATGAATATTG
TACAGTACCATAATTACTTGACTACCTGTAATACATAAAAACCTAATCCACATCAACCCCCCCCCCCCAT
GCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACAACTCCAAAGACACCCTTAC
ACCCACTAGGATATCAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACAT
AGCACATTATAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGA

>Neandertal-2 (AF011222.1)
GTTCTTTCATGGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAGCAACCGCTATGTAT
CTCGTACATTACTGTTAGTTACCATGAATATTGTACAGTACCATAATTACTTGACTACCTGCAGTACATA
AAAACCTAATCCACATCAAACCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTC
ATACATCAACTACAACTCCAAAGACGCCCTTACACCCACTAGGATATCAACAAACCTACCCACCCTTGAC
AGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGA
TGACCCCCCTCAGATAGGGGTCCCTTGAT

>Human (X90314.1)
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATT
TCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAA
AAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCA
CACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAG
TACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATG
ACCCCCCTCA

>Chimpanzee (AF176766.1)
GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGA
ATATTGTACAGTACTATAACCACTCAACTACCTATAATACATTAAGCCCACCCCCACATTACAACCTCCA
CCCTATGCTTACAAGCACGCACAACAATCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACAC
CCCTCTCCCACCCCGATACCAACAAACCTATGCCCTTTTAACAGTACATAGTACATACAGCCGTACATCG
CACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGATAGG

>Gorilla (AF089820.1)
TTCTTTCATGGGGAGACGAATTTGGGTGCCACCCAAGTATTAGTTAACCCACCAATAATTGTCATGTATG
TCGTGCATTACTGCCAGCCACCATGAATAATGTACAGTACCACAAACACTCCCCCACCTATAATACATTA
CCCCCCCTCACCCCCCATTCCCTGCTCACCCCAACGGCATACCAACCAACCTATCCCCTCACAAAAGTAC
ATAATACATAAAATCATTTACCGTCCATAGTACATTCCAGTTAAACCATCCTCGCCCCCACGGATGCCCC
CCTTCAGATAGGGATCCCTTAAA

>Orangutan (X97708.1)
TTCTTTCATGGGGGACCAGATTTGGGTGCCACCCCAGTACTGACCCATTTCTAACGGCCTATGTATTTCG
TACATTCCTGCTAGCCAACATGAATATCACCCAACACAACAATCGCTTAACCAACTATAATGCATACAAA
ACTCCAACCACACTCGACCTCCACACCCCGCTTACAAGCAAGTACCCCCCCATGCCCCCCCACCCAAACA
CATACACCGATCTCTCCACATAACCCCTCAACCCCCAGCATATCAACAGACCAAACAAACCTTAAAGTAC
ATAGCACATACTATCCTAACCGCACATAGCACATCCCGTTAAAACCCTGCTCATCCCCACGGATGCCCCC
CCTCAGTTAGTAATCCCTTACT

Please check it out and let me know what you think of it, i.e. do you like this format? Did you find it useful? Was I moving too fast, did I explain what I was doing thoroughly? And lastly, what would you like to see?

Michael Tomasello, a well known comparative psychologist, has a column in today’s New York Times where he writes on, “How Are Humans Unique?” In the piece, Tomasello argues that our cultural, linguistic, economic and tool-use have all come about because of our tendency for “collective cognition.”

His argument stems from two of his recent papers, the first, “Comparing Social Skills of Children and Apes,’ was authored along with Frans B. M. De Waal, Christophe Boesch, Victoria Horner, Andrew Whiten, Esther Herrmann, Josep Call, María Victoria Hernández-Lloreda, Brian Hare. Many of the same authors also joined Tomasello on the other paper, “Humans Have Evolved Specialized Skills of Social Cognition: The Cultural Intelligence Hypothesis,” which I covered on Primatology.net in September 2007.

The latter paper compared the congitive and problem solving skills of two & half-year-old human children to those of chimps and orangutans ranging from 3 to 21 years old. The results showed that both are comparable in numerical and spatial skills. When comparing social skills, the human kids excelled over the chimps. An example, the toddlers learned how to open a container by imitating what they saw, where as the chimps did not mimic… Thus, the kids made connections like, “stick helps open box.” The chimps relied on trick of trial and error. The authors summarized that imitation is a fast way acquire a lot of knowledge and may have paved the way for our departure from these primate cousins – and ultimately allowed us to develop the complex social culture we have today.

The more recent paper, also involved comparing the social and cognitive abilities of children and chimps. Tomasello and his team concluded that humans recognize and commit to group tasks. Chimps, on the other hand, do not have such expectation of others. If and when the chimps did communicate, they did it to get others to do what they want. I’ll confirm that from my own experience with working with apes, gorillas, that they communicated to me almost exclusively to get what they want. In their experiment, communication amongst children was to share information.

Tomasello argues that only humans pretend. According to him humans imagine, and this ability has allowed us to build institutions. These adaptations, Tomasello writes, set us apart from apes, thereby allowing us to build modern civilization.

I believe I have seen and experienced non-human imagination in gorillas and also chimps. I, by no means have the accolades that Tomasello has, nor the experiences he has in analyzing psychological research but I think it is really hard to definitively say that only humans can imagine and pretend. To do that we’d really have to get ino their minds. I just don’t understand how we can know if non-human primates do or do not imagine.

If you’re interested in this topic, we have in the past, had some short discussions on what traits have made humans unique, such as this one summarizing Marc Hauser’s postulates. I also think you’ll enjoy this 60 second audio summarizing the discussion, made by Christie Nicholson, of Scientific American — which she draws a tangent to social networking sites, something I commented about last September.

I have a podcast I found thru Dr. Hsien-Hsien Lei‘s blog, which actually came originally from Marc Pelletier of Futures in Biotech, that I wanna share withya. The podcast is fairly long, its about 45 minutes long.

Marc interviewed Dr. Svante Pääbo, Director of the Department of Genetics at the Max Planck Institute for Evolutionary Anthropology, and Dr. Thomas Jarvie, Technical Application Manager at 454 Life Sciences, on ancient DNA and the Neandertal Genome Project. Marc discusses with Drs. Pääbo and Jarvie the limitations and benefits of sequencing ancient DNA, such as its heavy fragmentation, and how 454′s sequencing technology is more logical than enzymatic amplification and other methods, such as bacterial cloning.

If this is a topic that interests you, you maybe interested to hear directly from the scientists in charge about what’s going on with their research.

[odeo=http://odeo.com/audio/14453223/view]

UPDATE: I just came across an Ars Technica discussion on evolving tools for ancient DNA, which also discusses the caveats to working with fragments of genomes.

Podcasting has arrived in a big way, as a cursory glance at the iTunes directory will confirm – if you can think of a science related topic, the chances are that someone somewhere will probably be talking about it. On that note, here’s a quick look at some which may be of interest to readers here – some are those I listen to, others were recommended to me by Carl at Hot Cup of Joe, (and who also contributes to Anthropology.net), so many thanks to him for his suggestions. All shows listed below are available for free via iTunes, but if you don’t use that application, I’ve provided a link to each of the sites, from where you can either listen or download direct.

All In The Mind – ABC

This show from Australia looks at issues involving psychology, with their two most recent shows looking at ‘mental surveillance’, discussing the unregulated domain of brain scanning in courts, our understanding of criminality, our susceptibility to becoming smokers or alcoholics based on our brain patterns, and a whole lot more – very well presented, and plenty to ponder over exactly how much free will we actually have.

Archaeology Channel

Here we have the weekly news from Archaeologica, who also run an excellent daily news service from their site.

n.b. The Archaeology Channel have an excellent range of video material on their site, the latest edition of which features an interview with Dr. Louise Leakey, yet another member of that famous family, discussing her work at Lake Turkana – also, be sure to check through their extensive archives for some very good presentations.

ClioaudioThis is produced by Alun Salt, formerly of Archaeoastronomy, and although still in its early days, has already covered some very interesting topics, including the debate between archaeologists and pagans, regarding how we should treat the ancient remains of individuals who are discovered during the course of digs or other excavations.

Dogma Free America

One of Carl Feagan’s recommendations, a show which evidently looks at the ongoing debate between science and religion – at the time of writing I haven’t had time to listen, but looking through their past show summaries, it looks as though there is a wealth of good material to catch up on.

From Our Own Correspondent

One of many from the BBC, this comes out quite often, sometimes twice in the same week. Each show features 3 separate reporters submitting a 10-minute piece from around the world, taking a look at people and places who wouldn’t necessarily make it into the headline news, but who nevertheless provide us with fascinating insights into any number of topics. Read the rest of this entry »