Today, I’d like to introduce you to the first installation in this series of tutorials on how to use commonly used bioinformatic tools such as a multiple sequence alignment and drawing a phylogenetic tree. Multiple sequence alignments and phylogenetic trees are used in evolutionary analyses to understand the similarities and differences in sequences of DNA, RNA, or amino acids. The basic premise is built off the understanding that more similar sequences are more related than dissimilar sequences.

In this episode, I compare the D-Loop sequence of the mitochondrial genome of two Neandertals, one modern human, a chimpanzee, gorilla and orangutan using Swami — a cohesive collection of commonly used tools. Swami allows us to do a mutliple sequence alignment and generate a phylogenetic tree. The results are displayed above and to the right. I’ve recorded this 7 min 30 second screencast for you to follow. If you’d like to give it a run for yourself, here’s the array of primate D-Loop sequences I’ve used:

>Neandertal-1 (AF254446.1)
CCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACATTACTGCCAGCCACCATGAATATTG
TACAGTACCATAATTACTTGACTACCTGTAATACATAAAAACCTAATCCACATCAACCCCCCCCCCCCAT
GCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACAACTCCAAAGACACCCTTAC
ACCCACTAGGATATCAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACAT
AGCACATTATAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGA

>Neandertal-2 (AF011222.1)
GTTCTTTCATGGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAGCAACCGCTATGTAT
CTCGTACATTACTGTTAGTTACCATGAATATTGTACAGTACCATAATTACTTGACTACCTGCAGTACATA
AAAACCTAATCCACATCAAACCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTC
ATACATCAACTACAACTCCAAAGACGCCCTTACACCCACTAGGATATCAACAAACCTACCCACCCTTGAC
AGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGA
TGACCCCCCTCAGATAGGGGTCCCTTGAT

>Human (X90314.1)
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATT
TCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAA
AAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCA
CACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAG
TACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATG
ACCCCCCTCA

>Chimpanzee (AF176766.1)
GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGA
ATATTGTACAGTACTATAACCACTCAACTACCTATAATACATTAAGCCCACCCCCACATTACAACCTCCA
CCCTATGCTTACAAGCACGCACAACAATCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACAC
CCCTCTCCCACCCCGATACCAACAAACCTATGCCCTTTTAACAGTACATAGTACATACAGCCGTACATCG
CACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGATAGG

>Gorilla (AF089820.1)
TTCTTTCATGGGGAGACGAATTTGGGTGCCACCCAAGTATTAGTTAACCCACCAATAATTGTCATGTATG
TCGTGCATTACTGCCAGCCACCATGAATAATGTACAGTACCACAAACACTCCCCCACCTATAATACATTA
CCCCCCCTCACCCCCCATTCCCTGCTCACCCCAACGGCATACCAACCAACCTATCCCCTCACAAAAGTAC
ATAATACATAAAATCATTTACCGTCCATAGTACATTCCAGTTAAACCATCCTCGCCCCCACGGATGCCCC
CCTTCAGATAGGGATCCCTTAAA

>Orangutan (X97708.1)
TTCTTTCATGGGGGACCAGATTTGGGTGCCACCCCAGTACTGACCCATTTCTAACGGCCTATGTATTTCG
TACATTCCTGCTAGCCAACATGAATATCACCCAACACAACAATCGCTTAACCAACTATAATGCATACAAA
ACTCCAACCACACTCGACCTCCACACCCCGCTTACAAGCAAGTACCCCCCCATGCCCCCCCACCCAAACA
CATACACCGATCTCTCCACATAACCCCTCAACCCCCAGCATATCAACAGACCAAACAAACCTTAAAGTAC
ATAGCACATACTATCCTAACCGCACATAGCACATCCCGTTAAAACCCTGCTCATCCCCACGGATGCCCCC
CCTCAGTTAGTAATCCCTTACT

Please check it out and let me know what you think of it, i.e. do you like this format? Did you find it useful? Was I moving too fast, did I explain what I was doing thoroughly? And lastly, what would you like to see?

His argument stems from two of his recent papers, the first, “Comparing Social Skills of Children and Apes,’ was authored along with Frans B. M. De Waal, Christophe Boesch, Victoria Horner, Andrew Whiten, Esther Herrmann, Josep Call, María Victoria Hernández-Lloreda, Brian Hare. Many of the same authors also joined Tomasello on the other paper, “Humans Have Evolved Specialized Skills of Social Cognition: The Cultural Intelligence Hypothesis,” which I covered on Primatology.net in September 2007.

The latter paper compared the congitive and problem solving skills of two & half-year-old human children to those of chimps and orangutans ranging from 3 to 21 years old. The results showed that both are comparable in numerical and spatial skills. When comparing social skills, the human kids excelled over the chimps. An example, the toddlers learned how to open a container by imitating what they saw, where as the chimps did not mimic… Thus, the kids made connections like, “stick helps open box.” The chimps relied on trick of trial and error. The authors summarized that imitation is a fast way acquire a lot of knowledge and may have paved the way for our departure from these primate cousins – and ultimately allowed us to develop the complex social culture we have today.

The more recent paper, also involved comparing the social and cognitive abilities of children and chimps. Tomasello and his team concluded that humans recognize and commit to group tasks. Chimps, on the other hand, do not have such expectation of others. If and when the chimps did communicate, they did it to get others to do what they want. I’ll confirm that from my own experience with working with apes, gorillas, that they communicated to me almost exclusively to get what they want. In their experiment, communication amongst children was to share information.

Tomasello argues that only humans pretend. According to him humans imagine, and this ability has allowed us to build institutions. These adaptations, Tomasello writes, set us apart from apes, thereby allowing us to build modern civilization.

I believe I have seen and experienced non-human imagination in gorillas and also chimps. I, by no means have the accolades that Tomasello has, nor the experiences he has in analyzing psychological research but I think it is really hard to definitively say that only humans can imagine and pretend. To do that we’d really have to get ino their minds. I just don’t understand how we can know if non-human primates do or do not imagine.

If you’re interested in this topic, we have in the past, had some short discussions on what traits have made humans unique, such as this one summarizing Marc Hauser’s postulates. I also think you’ll enjoy this 60 second audio summarizing the discussion, made by Christie Nicholson, of Scientific American — which she draws a tangent to social networking sites, something I commented about last September.

Marc interviewed Dr. Svante Pääbo, Director of the Department of Genetics at the Max Planck Institute for Evolutionary Anthropology, and Dr. Thomas Jarvie, Technical Application Manager at 454 Life Sciences, on ancient DNA and the Neandertal Genome Project. Marc discusses with Drs. Pääbo and Jarvie the limitations and benefits of sequencing ancient DNA, such as its heavy fragmentation, and how 454′s sequencing technology is more logical than enzymatic amplification and other methods, such as bacterial cloning.

If this is a topic that interests you, you maybe interested to hear directly from the scientists in charge about what’s going on with their research.

[odeo=http://odeo.com/audio/14453223/view]

UPDATE: I just came across an Ars Technica discussion on evolving tools for ancient DNA, which also discusses the caveats to working with fragments of genomes.

All In The Mind – ABC

This show from Australia looks at issues involving psychology, with their two most recent shows looking at ‘mental surveillance’, discussing the unregulated domain of brain scanning in courts, our understanding of criminality, our susceptibility to becoming smokers or alcoholics based on our brain patterns, and a whole lot more – very well presented, and plenty to ponder over exactly how much free will we actually have.

Archaeology Channel

Here we have the weekly news from Archaeologica, who also run an excellent daily news service from their site.

n.b. The Archaeology Channel have an excellent range of video material on their site, the latest edition of which features an interview with Dr. Louise Leakey, yet another member of that famous family, discussing her work at Lake Turkana – also, be sure to check through their extensive archives for some very good presentations.

ClioaudioThis is produced by Alun Salt, formerly of Archaeoastronomy, and although still in its early days, has already covered some very interesting topics, including the debate between archaeologists and pagans, regarding how we should treat the ancient remains of individuals who are discovered during the course of digs or other excavations.

Dogma Free America

One of Carl Feagan’s recommendations, a show which evidently looks at the ongoing debate between science and religion – at the time of writing I haven’t had time to listen, but looking through their past show summaries, it looks as though there is a wealth of good material to catch up on.

From Our Own Correspondent

One of many from the BBC, this comes out quite often, sometimes twice in the same week. Each show features 3 separate reporters submitting a 10-minute piece from around the world, taking a look at people and places who wouldn’t necessarily make it into the headline news, but who nevertheless provide us with fascinating insights into any number of topics.

In Our Time

Another from the BBC, this one featuring presenter Melvyn Bragg and a handful of specialist guests brought in for each edition, who address a specific topic each week – the current edition looks at the Permian/Triassic extinction event, which wiped out over 95% of all life, some 250 million years ago.

New Scientist

Also known as Scipod, this is a joint UK/US effort, and each week the two presenters take a look at topics typically covered in their magazine – this week it’s Richard Wiseman on something called ‘quirkology’.

Point Of Enquiry

I only came across this recently, and this is a pretty good one – here’s my write up from remote central – “Each issue features a different guest, many of whom will be instantly recognisable – Phil Plait, Steven Pinker, Susan Blackmore, Richard Wiseman, Dennett and Dawkins, with even Salman Rushdie popping in for a visit. At the moment I’m listening to Prof. Eugenie Scott, of the Dover, Pa. 2005 trial fame, discussing Creationism masquerading as Intelligent Design, and the attempts by some to have both subjects taught together in the science classroom.”

Royal Society

A mix of video and podcasting, not sure of this is still up and running as there have been no new editions since early May, but their past shows are still available.

RU Sirius Show

I actually first heard of this when Martin at Aardvarchaeology recommended it on his site. This is a long established show, and although not strictly tied to anthropology, nevertheless features plenty of material that will be of interest to many – current edition looks at ‘Cyborgs, revolution and Steve Wozniak‘.

Science Talk

This is from Scientific American, and is a weekly look at science and technology in the news, as well as a host of other related topics discussed with different guests, always something of interest – SciAm have also started posting related video news content on their site, including a companion piece to their recent feature ‘Earth Without Humans‘, which looks at how New York would become transformed over the years, were we humans to suddenly vanish from the scene.

Skeptico

This is another podcast which dealing with issues of faith, belief, and topics such as scientific evidence, or lack thereof, for the afterlife – again, one I haven’t had the chance to check thoroughly, but one that promises to have some good discussion – the latest edition focusses on what is described as the battle between religious and scientific fundamentalism, and looks at ways in which some type of compromise can be reached between the two sides to take the arguments forward, rather than becoming enmired in the morass of verbal mudslinging which seems on occasion to dominate any debate.

Skeptics Guide To The Universe

Another recommendation by Carl, haven’t had a chance to properly listen yet, but the snoppets I’ve heard bode well for future listening – their latest issue discusses ‘News Items: Do black holes exist, President bush veto’s new stem cell bill, Legends for profit;‘

This Week In Science

The final show to be featured here, which describes itself as ‘the kickass science podcast’ and again, one recommended by Carl – this is another show I’ll have a listen to more fully later, and they certainly appear to tackle a formidable range of topics, with interviews, so it should have something of interest for all. There’s also a link from their main page to Seed Magazine’s ‘Science Writing Contest‘, which I imagine would attract the interest, and again, what little I’ve heard, is very well presented.

So that’s it for now – doubtless there are other podcasts out there of which I’m unaware, but hopefully those mentioned above will prove useful and hopefully entertaining to readers here – it’s just a question of finding the time to listen to them all , but one of the best thing about podcasting is that we’re no longer tied to radio schedules, which in the past, all too often meant that a show missed one week, was effectively a show missed for ever. Happy listening. (TJ)

image from here