Archive for the ‘Video’ Category
Dopamine & Anticipating Rewards
I am now two-thirds done with my psychiatry rotation. It has been a fascinating experience so far. I’ve seen the gamut of psychiatric cases, depressed people who cut their necks through and through, to florid schizophrenics worried that the Hiroshima bomb will go off any moment. The treatment of psychiatric conditions like depression or schizophrenia often revolves around regulating monoamine neurotransmitters like serotonin, norepinephrine and dopamine.
Dopamine is an important neurotransmitter that functions in a lot of behaviors and reactions, such as movement, lactation, aggression, fear, etc. In diseases like Parkinson, dopamine levels lower and movement becomes uncontrolled. In other diseases like schizophrenia, either dopamine levels are high or response to dopamine is higher, and paranoia & hallucinations manifest. Treating schizophrenia involves blocking dopamine receptors. As you can imagine, a common side effect of antipsychotics is movement disorders — or Parkinsonism.
So why am I on this neuropsychiatric kick on an anthropology blog? Our cultural and behavioral predisopostions ultimately boil down to chemicals in our brain interacting and stimulating other areas. One of the most important functions of dopamine is in the reward system of the brain, an area called the nucleus accumbens that primes pleasurable behavior to repeat, such as sex, eating, and drugs.
In this video, Robert Sapolsky of Stanford Neurology makes the distinction between how dopamine levels rise in the anticipation of pleasure and not as a response to pleasure. I especially like that comment he made regarding reward and religion, “There’s no monkey out there willing to lever press because St. Peter is down the line.”
Cave of Forgotten Dreams
Another video to share with you, this time the trailer to Werner Herzog‘s Cave of Forgotten Dreams. This is a 3D film shot inside Chauvet-Pont-d’Arc Cave in southern France. These are some of the oldest cave paintings known. The film seems to have good reviews on IMDB and is set to be released on March 25th, 2011 in the UK.
What do you think?
BBC’s Human Planet
This seems really fascinating.
Mayas Saving Maya Culture – The Archaeology Channel
The latest offering from the Archaeology Channel is now online, and in this 22 minute video produced by Timothy Knowlton, which in
brief is described thus:
An association of Tz’utujil Maya people from Santiago Atitlán, Guatemala, struggle to establish a cultural center and archaeological site museum at the nearby lakeside site of Chuitinamit, once home to the Pre-Hispanic Maya King Tepepul and now badly looted. Including a tour of the museum, this film documents their accomplishments thus far and current endeavors in the face of artifact looting and natural catastrophe in the form of Hurricane Stan, which struck in 2005.
We get a pretty interesting tour of the museum in which traditional clothing and associated artefacts are shown and described, but it’s a much starker experience as we are shown around nearby sites that have been looted – this time the culprits don’t appear to be avaricious collectors with an eye for the illegal antiquities trade, rather local people who see items such as stelae, altars and sacrificial stones as ideal material for local construction projects. According to the film, such people contend that these ancient artefacts have no cultural relevance to them, and considering that many people struggle to earn anything approaching a decent wage, it’s hardly surprising they exploit free building materials when opportunity arises.
Those artefacts have now disappeared and can never be replaced, and whether there are plans to educate people in order that they understand and protect their own heritage is uncertain, although it could of course be argued that even those people who do come to realise the value of similar artefacts will still be poor over the coming years, and understandably will likely view heritage they can recover from local sites as an income stream – just as has been the case in recent years in places like Iraq, Cambodia and so on.
Obviously we hope that the efforts of those appearing in the video as our guides will fare better in the coming years, and be able to stem the flow of losses currently afflicting this site and many others in a similar predicament.
There are several outgoing links from the video page, and the image of Chuitinamit, also known as Chiyá, is from one of them, Authentic Maya.
This seems a good opportunity to mention a news item that appeared last week from the University of California, Santa Barbara, which features archaeologist Anabel Ford, who is also a director of the university’s MesoAmerican Research Center. It is her contention that contrary to the idea that the Maya brought about their own downfall about 1,000 years ago by imprudent slash-and-burn treatment of their lands, they were in fact highly sophisticated in their land management. In a recent paper, Origins of the Maya Forest Garden: Maya Resource Management, Ford begs to differ with previously held views, as we see from the abstract:
There is growing interest in the ecology of the Maya Forest past, present, and future, as well as in the role of humans in the transformation of this ecosystem. In this paper, we bring together and re-evaluate paleoenvironmental, ethnobiological, and archaeological data to reconstruct the related effects of climatic shifts and human adaptations to and alterations of the lowland Maya Forest. In particular, we consider the paleoenvironmental data from the Maya Forest area in light of interpretations of the precipitation record from the Cariaco Basin.
During the Archaic period, a time of stable climatic conditions 8,000–4,000 years ago, we propose that the ancestral Maya established an intimate relationship with an expanding tropical forest, modifying the landscape to meet their subsistence needs. We propose that the succeeding period of climatic chaos during the Preclassic period, 4,000–1,750 years ago, provoked the adaptation to settled agrarian life. This new adaptation, we suggest, was based on a resource management strategy that grew out of earlier landscape modification practices.
Eventually, this resulted in a highly managed landscape that we call the Maya Forest Garden. This highly productive and sustainable system of resource management formed the foundation for the development of the Maya civilization, from 3,000 to 1,000 years ago, and was intensified during the latter millennia of a stable climatic regime as population grew and the civilization developed. These strategies of living in the forest evolved into the milpa cycle—the axis of the Maya Forest garden resource management system that created the extraordinary economic value recognized in the Maya Forest today.
Reference: Origins of the Maya Forest Garden: Maya Resource Management – Anabel Ford and Ronald Nigh, Journal of Ethnobiology 29(2):213-236. 2009 doi: 10.2993/0278-0771-29.2.213
The Real Pliocene Hominin
A Quick Review Of NOVA’s “Alien From Earth”
I watched that NOVA special on Homo floresiensis last night. It was extremely well done. The producers covered a lot of angles, interviewed many key players, presented the information in a clear manner and kept it entertaining. I wish more anthropology related documentaries would use this show as a template.
In lieu of resonating more noise in the echo chamber, I’ll pass you onto John Hawks‘ minute by minute review of the show. But I do want to say the show really effectively addressed some of the critics of the Flores hobbit, including me, by reminding us that evolution is not linear. And even though we’ve seen a linear pattern in previous hominid brain size growth patterns and associated archaeological complexity, it is possible a smaller brained hominid also evolved simultaneously. If I were teaching a paleoanthropology class, I would show this documentary for sure.
For those of you who couldn’t watch it, it is online now in both Quicktime and Windows Media formats. Watch it.
Paleoanthropologist Louise Leakey’s TEDtalk
Every year TED invites esteemed academics, thinkers, doers, entrepreneurs, etc. to give an exclusive 15-18 minute long talk about what they do and why it is important for the rest of the world. I’ve shared one of these talks with you before, Zeresenay Alemseged’s. In this year’s conference, Louise Leakey, of the Leakey family lineage of paleoanthropologists, talks about her life history and the importance of finding fossil hominids.
She emphasizes how hard it is to find fossils, her view of hominid diversity, and her accounts of when Turkana Boy was found and excavated when she was 12 years old. She also weaves in points about how our population growth needs to be moderated. If you got 15 minutes to spare, I recommend watching it to know a bit more about how fossils are found and the Leakey legacy.
Episode 1: A ScreenCast Tutorial On How-To Do A Multiple Sequence Alignment & Draw A Phylogenetic Tree Using Swami
The last time I did a little tutorial on how to use bioinformatic tools in anthropological research was last October. I’ve had some ideas since then and have decided to restart this project. The biggest change is the screencast format, rather than a set of static instructions.
Today, I’d like to introduce you to the first installation in this series of tutorials on how to use commonly used bioinformatic tools such as a multiple sequence alignment and drawing a phylogenetic tree. Multiple sequence alignments and phylogenetic trees are used in evolutionary analyses to understand the similarities and differences in sequences of DNA, RNA, or amino acids. The basic premise is built off the understanding that more similar sequences are more related than dissimilar sequences.
In this episode, I compare the D-Loop sequence of the mitochondrial genome of two Neandertals, one modern human, a chimpanzee, gorilla and orangutan using Swami — a cohesive collection of commonly used tools. Swami allows us to do a mutliple sequence alignment and generate a phylogenetic tree. The results are displayed above and to the right. I’ve recorded this 7 min 30 second screencast for you to follow. If you’d like to give it a run for yourself, here’s the array of primate D-Loop sequences I’ve used:
>Neandertal-1 (AF254446.1) CCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACATTACTGCCAGCCACCATGAATATTG TACAGTACCATAATTACTTGACTACCTGTAATACATAAAAACCTAATCCACATCAACCCCCCCCCCCCAT GCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACAACTCCAAAGACACCCTTAC ACCCACTAGGATATCAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACAT AGCACATTATAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGA >Neandertal-2 (AF011222.1) GTTCTTTCATGGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAGCAACCGCTATGTAT CTCGTACATTACTGTTAGTTACCATGAATATTGTACAGTACCATAATTACTTGACTACCTGCAGTACATA AAAACCTAATCCACATCAAACCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTC ATACATCAACTACAACTCCAAAGACGCCCTTACACCCACTAGGATATCAACAAACCTACCCACCCTTGAC AGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGA TGACCCCCCTCAGATAGGGGTCCCTTGAT >Human (X90314.1) TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATT TCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAA AAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCA CACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAG TACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATG ACCCCCCTCA >Chimpanzee (AF176766.1) GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGA ATATTGTACAGTACTATAACCACTCAACTACCTATAATACATTAAGCCCACCCCCACATTACAACCTCCA CCCTATGCTTACAAGCACGCACAACAATCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACAC CCCTCTCCCACCCCGATACCAACAAACCTATGCCCTTTTAACAGTACATAGTACATACAGCCGTACATCG CACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGATAGG >Gorilla (AF089820.1) TTCTTTCATGGGGAGACGAATTTGGGTGCCACCCAAGTATTAGTTAACCCACCAATAATTGTCATGTATG TCGTGCATTACTGCCAGCCACCATGAATAATGTACAGTACCACAAACACTCCCCCACCTATAATACATTA CCCCCCCTCACCCCCCATTCCCTGCTCACCCCAACGGCATACCAACCAACCTATCCCCTCACAAAAGTAC ATAATACATAAAATCATTTACCGTCCATAGTACATTCCAGTTAAACCATCCTCGCCCCCACGGATGCCCC CCTTCAGATAGGGATCCCTTAAA >Orangutan (X97708.1) TTCTTTCATGGGGGACCAGATTTGGGTGCCACCCCAGTACTGACCCATTTCTAACGGCCTATGTATTTCG TACATTCCTGCTAGCCAACATGAATATCACCCAACACAACAATCGCTTAACCAACTATAATGCATACAAA ACTCCAACCACACTCGACCTCCACACCCCGCTTACAAGCAAGTACCCCCCCATGCCCCCCCACCCAAACA CATACACCGATCTCTCCACATAACCCCTCAACCCCCAGCATATCAACAGACCAAACAAACCTTAAAGTAC ATAGCACATACTATCCTAACCGCACATAGCACATCCCGTTAAAACCCTGCTCATCCCCACGGATGCCCCC CCTCAGTTAGTAATCCCTTACT
Please check it out and let me know what you think of it, i.e. do you like this format? Did you find it useful? Was I moving too fast, did I explain what I was doing thoroughly? And lastly, what would you like to see?
A ‘Re-Review’ of Journey to 10,000 B.C.
Several weeks ago, a public relations company contacted me to let me know about the release of the History Channel’s Journey 10,000 B.C.
and if I’d like a review copy. I said sure, despite the fact that I viewed the original airing of the show in March and wrote up an unfavorable review of it. But I didn’t say anything.
I was kinda surprised that the P.R. person, who went thru the effort of contacting me, didn’t extend that effort on researching if I hadn’t already reviewed the show. Actually I’m kinda dumbfounded, given that my original review is currently the second hit on Google for the search string, “Journey to 10,000 B.C.” It takes a few seconds to do that search, and for a company that ‘cultivates word-of-mouth measurably… through authentic social media,’ I feel as if they failed massively.
Anyways, the person sent me a copy of the DVD to review. I checked out the DVD. Nothing has changed since the original airing of show. The production value is still as crappy as it was when it first aired, and the most interesting argument made in the show is the review of the Soluteran peopling of the Americas, albeit it is a very far fetched, unsubstantiated hypothesis. I do not recommend you shell out your time and money to see this documentary.
I really don’t know why I’m blogging about this, I kinda feel obligated to do since she recently reminded me that she sent the DVD and is looking forward to a review of it. If this individual did her homework before she pitched the product to me, I wouldn’t have continued to make this point… perhaps something can be learned from this, do a quick Google search!
Paul Ehrlich and Carl Zimmer discuss Cultural Evolution on Bloggingheads.tv
I have brought up Paul Ehrlich a lot lately. And this morning Razib emailed me a link to an interview of Ehrlich by Carl Zimmer on Bloggingheads.tv, so I felt compelled to share the interview with you.
In the discussion, Zimmer and Ehrlich discuss Ehrlich’s new book, “The Dominant Animal, the ‘overrated idea of a meme,’ why the study of cultural evolution needs its own theoretical framework aside from evolutionary biology.
I’m particularly interested in the last topic, which comes in at the 20 minute mark, since Ehrlich coauthors links to natural selection in his latest PNAS paper but advocates that social scientists need to step up to the plate and explain why cultures have evolved. The most noteworthy remark Ehrlich makes on this topic is,
“The ball is really in the court of social scientists today. They’ve got to get reorganized and particularly get rid of their preposterous disciplinary boundaries. How can you possibly be a political scientists without knowing economics and sociology and vice versa.”
The two also talk about other selected topics on population growth and the nuances that come with it.
