Tags

, , , ,

The last time I did a little tutorial on how to use bioinformatic tools in anthropological research was last October. I’ve had some ideas since then and have decided to restart this project. The biggest change is the screencast format, rather than a set of static instructions.

Today, I’d like to introduce you to the first installation in this series of tutorials on how to use commonly used bioinformatic tools such as a multiple sequence alignment and drawing a phylogenetic tree. Multiple sequence alignments and phylogenetic trees are used in evolutionary analyses to understand the similarities and differences in sequences of DNA, RNA, or amino acids. The basic premise is built off the understanding that more similar sequences are more related than dissimilar sequences.

In this episode, I compare the D-Loop sequence of the mitochondrial genome of two Neandertals, one modern human, a chimpanzee, gorilla and orangutan using Swami — a cohesive collection of commonly used tools. Swami allows us to do a mutliple sequence alignment and generate a phylogenetic tree. The results are displayed above and to the right. I’ve recorded this 7 min 30 second screencast for you to follow. If you’d like to give it a run for yourself, here’s the array of primate D-Loop sequences I’ve used:

>Neandertal-1 (AF254446.1)
CCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACATTACTGCCAGCCACCATGAATATTG
TACAGTACCATAATTACTTGACTACCTGTAATACATAAAAACCTAATCCACATCAACCCCCCCCCCCCAT
GCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACAACTCCAAAGACACCCTTAC
ACCCACTAGGATATCAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACAT
AGCACATTATAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGA

>Neandertal-2 (AF011222.1)
GTTCTTTCATGGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAGCAACCGCTATGTAT
CTCGTACATTACTGTTAGTTACCATGAATATTGTACAGTACCATAATTACTTGACTACCTGCAGTACATA
AAAACCTAATCCACATCAAACCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTC
ATACATCAACTACAACTCCAAAGACGCCCTTACACCCACTAGGATATCAACAAACCTACCCACCCTTGAC
AGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGA
TGACCCCCCTCAGATAGGGGTCCCTTGAT

>Human (X90314.1)
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATT
TCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAA
AAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCA
CACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAG
TACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATG
ACCCCCCTCA

>Chimpanzee (AF176766.1)
GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGA
ATATTGTACAGTACTATAACCACTCAACTACCTATAATACATTAAGCCCACCCCCACATTACAACCTCCA
CCCTATGCTTACAAGCACGCACAACAATCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACAC
CCCTCTCCCACCCCGATACCAACAAACCTATGCCCTTTTAACAGTACATAGTACATACAGCCGTACATCG
CACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGATAGG

>Gorilla (AF089820.1)
TTCTTTCATGGGGAGACGAATTTGGGTGCCACCCAAGTATTAGTTAACCCACCAATAATTGTCATGTATG
TCGTGCATTACTGCCAGCCACCATGAATAATGTACAGTACCACAAACACTCCCCCACCTATAATACATTA
CCCCCCCTCACCCCCCATTCCCTGCTCACCCCAACGGCATACCAACCAACCTATCCCCTCACAAAAGTAC
ATAATACATAAAATCATTTACCGTCCATAGTACATTCCAGTTAAACCATCCTCGCCCCCACGGATGCCCC
CCTTCAGATAGGGATCCCTTAAA

>Orangutan (X97708.1)
TTCTTTCATGGGGGACCAGATTTGGGTGCCACCCCAGTACTGACCCATTTCTAACGGCCTATGTATTTCG
TACATTCCTGCTAGCCAACATGAATATCACCCAACACAACAATCGCTTAACCAACTATAATGCATACAAA
ACTCCAACCACACTCGACCTCCACACCCCGCTTACAAGCAAGTACCCCCCCATGCCCCCCCACCCAAACA
CATACACCGATCTCTCCACATAACCCCTCAACCCCCAGCATATCAACAGACCAAACAAACCTTAAAGTAC
ATAGCACATACTATCCTAACCGCACATAGCACATCCCGTTAAAACCCTGCTCATCCCCACGGATGCCCCC
CCTCAGTTAGTAATCCCTTACT

Please check it out and let me know what you think of it, i.e. do you like this format? Did you find it useful? Was I moving too fast, did I explain what I was doing thoroughly? And lastly, what would you like to see?

[blip.tv ?posts_id=1081730&dest=-1]

Advertisements